ID: 1003225002

View in Genome Browser
Species Human (GRCh38)
Location 6:4195837-4195859
Sequence AAGGGTCTACAGAAGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003224996_1003225002 12 Left 1003224996 6:4195802-4195824 CCTCCCAAAACACAAAAATAATA No data
Right 1003225002 6:4195837-4195859 AAGGGTCTACAGAAGGTTCATGG No data
1003224997_1003225002 9 Left 1003224997 6:4195805-4195827 CCCAAAACACAAAAATAATAGAC No data
Right 1003225002 6:4195837-4195859 AAGGGTCTACAGAAGGTTCATGG No data
1003224998_1003225002 8 Left 1003224998 6:4195806-4195828 CCAAAACACAAAAATAATAGACA No data
Right 1003225002 6:4195837-4195859 AAGGGTCTACAGAAGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003225002 Original CRISPR AAGGGTCTACAGAAGGTTCA TGG Intergenic
No off target data available for this crispr