ID: 1003225518

View in Genome Browser
Species Human (GRCh38)
Location 6:4202093-4202115
Sequence TGTTTAATGTTGACAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003225512_1003225518 13 Left 1003225512 6:4202057-4202079 CCTGGATATCCTTGTTAACTTTC 0: 1971
1: 2961
2: 4902
3: 2274
4: 1449
Right 1003225518 6:4202093-4202115 TGTTTAATGTTGACAGTGGGGGG No data
1003225513_1003225518 4 Left 1003225513 6:4202066-4202088 CCTTGTTAACTTTCTGTCTCATT 0: 880
1: 3395
2: 4335
3: 2125
4: 1321
Right 1003225518 6:4202093-4202115 TGTTTAATGTTGACAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003225518 Original CRISPR TGTTTAATGTTGACAGTGGG GGG Intergenic
No off target data available for this crispr