ID: 1003226514

View in Genome Browser
Species Human (GRCh38)
Location 6:4210934-4210956
Sequence CAGTGGGTGAGGCGGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003226514_1003226525 0 Left 1003226514 6:4210934-4210956 CCCGCCCCCCGCCTCACCCACTG No data
Right 1003226525 6:4210957-4210979 AAGACTGAGTGACCTGGAATAGG No data
1003226514_1003226527 15 Left 1003226514 6:4210934-4210956 CCCGCCCCCCGCCTCACCCACTG No data
Right 1003226527 6:4210972-4210994 GGAATAGGAGTATTCTAAACTGG No data
1003226514_1003226528 19 Left 1003226514 6:4210934-4210956 CCCGCCCCCCGCCTCACCCACTG No data
Right 1003226528 6:4210976-4210998 TAGGAGTATTCTAAACTGGAAGG No data
1003226514_1003226524 -6 Left 1003226514 6:4210934-4210956 CCCGCCCCCCGCCTCACCCACTG No data
Right 1003226524 6:4210951-4210973 CCACTGAAGACTGAGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003226514 Original CRISPR CAGTGGGTGAGGCGGGGGGC GGG (reversed) Intergenic
No off target data available for this crispr