ID: 1003227976

View in Genome Browser
Species Human (GRCh38)
Location 6:4223585-4223607
Sequence CTCCAGGAGGGACTCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003227976_1003227984 6 Left 1003227976 6:4223585-4223607 CCCACATGGAGTCCCTCCTGGAG No data
Right 1003227984 6:4223614-4223636 CTAGTGGAACTGTGAGAAGAGGG 0: 108
1: 1868
2: 2055
3: 1304
4: 917
1003227976_1003227983 5 Left 1003227976 6:4223585-4223607 CCCACATGGAGTCCCTCCTGGAG No data
Right 1003227983 6:4223613-4223635 CCTAGTGGAACTGTGAGAAGAGG 0: 100
1: 1767
2: 2068
3: 1420
4: 869
1003227976_1003227980 -10 Left 1003227976 6:4223585-4223607 CCCACATGGAGTCCCTCCTGGAG No data
Right 1003227980 6:4223598-4223620 CCTCCTGGAGCACTGCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003227976 Original CRISPR CTCCAGGAGGGACTCCATGT GGG (reversed) Intergenic
No off target data available for this crispr