ID: 1003231391

View in Genome Browser
Species Human (GRCh38)
Location 6:4256832-4256854
Sequence GAGTTTGAACAGAGGAAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003231386_1003231391 27 Left 1003231386 6:4256782-4256804 CCTGATCTCAACTGATAGCATGG No data
Right 1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003231391 Original CRISPR GAGTTTGAACAGAGGAAAGA CGG Intergenic
No off target data available for this crispr