ID: 1003232248

View in Genome Browser
Species Human (GRCh38)
Location 6:4264985-4265007
Sequence GTGCACCATCTCTGAAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003232243_1003232248 1 Left 1003232243 6:4264961-4264983 CCCCATTCATGTGAGCTTAGCAT No data
Right 1003232248 6:4264985-4265007 GTGCACCATCTCTGAAGCCTGGG No data
1003232244_1003232248 0 Left 1003232244 6:4264962-4264984 CCCATTCATGTGAGCTTAGCATG No data
Right 1003232248 6:4264985-4265007 GTGCACCATCTCTGAAGCCTGGG No data
1003232245_1003232248 -1 Left 1003232245 6:4264963-4264985 CCATTCATGTGAGCTTAGCATGG No data
Right 1003232248 6:4264985-4265007 GTGCACCATCTCTGAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003232248 Original CRISPR GTGCACCATCTCTGAAGCCT GGG Intergenic
No off target data available for this crispr