ID: 1003233410

View in Genome Browser
Species Human (GRCh38)
Location 6:4274968-4274990
Sequence CTGTGTTGCCATATAGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003233410_1003233412 -5 Left 1003233410 6:4274968-4274990 CCAACCTCTATATGGCAACACAG No data
Right 1003233412 6:4274986-4275008 CACAGATCATAAGCACAGAAAGG No data
1003233410_1003233415 28 Left 1003233410 6:4274968-4274990 CCAACCTCTATATGGCAACACAG No data
Right 1003233415 6:4275019-4275041 CAACTGGTGTTATGTTTGATGGG No data
1003233410_1003233413 12 Left 1003233410 6:4274968-4274990 CCAACCTCTATATGGCAACACAG No data
Right 1003233413 6:4275003-4275025 GAAAGGAACTGTGTTACAACTGG No data
1003233410_1003233414 27 Left 1003233410 6:4274968-4274990 CCAACCTCTATATGGCAACACAG No data
Right 1003233414 6:4275018-4275040 ACAACTGGTGTTATGTTTGATGG No data
1003233410_1003233416 29 Left 1003233410 6:4274968-4274990 CCAACCTCTATATGGCAACACAG No data
Right 1003233416 6:4275020-4275042 AACTGGTGTTATGTTTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003233410 Original CRISPR CTGTGTTGCCATATAGAGGT TGG (reversed) Intergenic
No off target data available for this crispr