ID: 1003233411

View in Genome Browser
Species Human (GRCh38)
Location 6:4274972-4274994
Sequence TGATCTGTGTTGCCATATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003233411_1003233412 -9 Left 1003233411 6:4274972-4274994 CCTCTATATGGCAACACAGATCA No data
Right 1003233412 6:4274986-4275008 CACAGATCATAAGCACAGAAAGG No data
1003233411_1003233415 24 Left 1003233411 6:4274972-4274994 CCTCTATATGGCAACACAGATCA No data
Right 1003233415 6:4275019-4275041 CAACTGGTGTTATGTTTGATGGG No data
1003233411_1003233416 25 Left 1003233411 6:4274972-4274994 CCTCTATATGGCAACACAGATCA No data
Right 1003233416 6:4275020-4275042 AACTGGTGTTATGTTTGATGGGG No data
1003233411_1003233413 8 Left 1003233411 6:4274972-4274994 CCTCTATATGGCAACACAGATCA No data
Right 1003233413 6:4275003-4275025 GAAAGGAACTGTGTTACAACTGG No data
1003233411_1003233414 23 Left 1003233411 6:4274972-4274994 CCTCTATATGGCAACACAGATCA No data
Right 1003233414 6:4275018-4275040 ACAACTGGTGTTATGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003233411 Original CRISPR TGATCTGTGTTGCCATATAG AGG (reversed) Intergenic
No off target data available for this crispr