ID: 1003233413

View in Genome Browser
Species Human (GRCh38)
Location 6:4275003-4275025
Sequence GAAAGGAACTGTGTTACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003233410_1003233413 12 Left 1003233410 6:4274968-4274990 CCAACCTCTATATGGCAACACAG No data
Right 1003233413 6:4275003-4275025 GAAAGGAACTGTGTTACAACTGG No data
1003233409_1003233413 13 Left 1003233409 6:4274967-4274989 CCCAACCTCTATATGGCAACACA No data
Right 1003233413 6:4275003-4275025 GAAAGGAACTGTGTTACAACTGG No data
1003233411_1003233413 8 Left 1003233411 6:4274972-4274994 CCTCTATATGGCAACACAGATCA No data
Right 1003233413 6:4275003-4275025 GAAAGGAACTGTGTTACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003233413 Original CRISPR GAAAGGAACTGTGTTACAAC TGG Intergenic
No off target data available for this crispr