ID: 1003235799

View in Genome Browser
Species Human (GRCh38)
Location 6:4294479-4294501
Sequence CCTAGAACCTGGATCGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003235799_1003235805 11 Left 1003235799 6:4294479-4294501 CCAGTAACGATCCAGGTTCTAGG No data
Right 1003235805 6:4294513-4294535 GAGACAGAGCTTTCCAGACCTGG No data
1003235799_1003235806 12 Left 1003235799 6:4294479-4294501 CCAGTAACGATCCAGGTTCTAGG No data
Right 1003235806 6:4294514-4294536 AGACAGAGCTTTCCAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003235799 Original CRISPR CCTAGAACCTGGATCGTTAC TGG (reversed) Intergenic
No off target data available for this crispr