ID: 1003236969

View in Genome Browser
Species Human (GRCh38)
Location 6:4303395-4303417
Sequence CCAGCAGAGACTGTTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003236969_1003236978 16 Left 1003236969 6:4303395-4303417 CCAGCCCCAACAGTCTCTGCTGG No data
Right 1003236978 6:4303434-4303456 TAAATTTTATTCTGTCTGGTTGG No data
1003236969_1003236977 12 Left 1003236969 6:4303395-4303417 CCAGCCCCAACAGTCTCTGCTGG No data
Right 1003236977 6:4303430-4303452 ATGTTAAATTTTATTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003236969 Original CRISPR CCAGCAGAGACTGTTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr