ID: 1003245413

View in Genome Browser
Species Human (GRCh38)
Location 6:4378359-4378381
Sequence CCTTCCACACAGGGCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003245409_1003245413 -8 Left 1003245409 6:4378344-4378366 CCTGGGGGAGGTGCTCCTTCCAC No data
Right 1003245413 6:4378359-4378381 CCTTCCACACAGGGCCCTGAAGG No data
1003245402_1003245413 16 Left 1003245402 6:4378320-4378342 CCTGGAGAGAGTGGGCTGGTTCT No data
Right 1003245413 6:4378359-4378381 CCTTCCACACAGGGCCCTGAAGG No data
1003245401_1003245413 19 Left 1003245401 6:4378317-4378339 CCACCTGGAGAGAGTGGGCTGGT No data
Right 1003245413 6:4378359-4378381 CCTTCCACACAGGGCCCTGAAGG No data
1003245408_1003245413 -7 Left 1003245408 6:4378343-4378365 CCCTGGGGGAGGTGCTCCTTCCA No data
Right 1003245413 6:4378359-4378381 CCTTCCACACAGGGCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003245413 Original CRISPR CCTTCCACACAGGGCCCTGA AGG Intergenic