ID: 1003253066

View in Genome Browser
Species Human (GRCh38)
Location 6:4449443-4449465
Sequence GTGGAAAAGAAGGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003253061_1003253066 9 Left 1003253061 6:4449411-4449433 CCTTGGTTTTTAGTTTCTGTCTC 0: 56
1: 73
2: 34
3: 60
4: 539
Right 1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG No data
1003253060_1003253066 16 Left 1003253060 6:4449404-4449426 CCTGACGCCTTGGTTTTTAGTTT No data
Right 1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003253066 Original CRISPR GTGGAAAAGAAGGATGAGGA AGG Intergenic
No off target data available for this crispr