ID: 1003253638

View in Genome Browser
Species Human (GRCh38)
Location 6:4455548-4455570
Sequence CTGCTGTGCTTGGGAAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003253638_1003253643 7 Left 1003253638 6:4455548-4455570 CCAGGGTTTCCCAAGCACAGCAG No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data
1003253638_1003253642 -2 Left 1003253638 6:4455548-4455570 CCAGGGTTTCCCAAGCACAGCAG No data
Right 1003253642 6:4455569-4455591 AGGTTTACTGAAGAATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003253638 Original CRISPR CTGCTGTGCTTGGGAAACCC TGG (reversed) Intergenic
No off target data available for this crispr