ID: 1003253642

View in Genome Browser
Species Human (GRCh38)
Location 6:4455569-4455591
Sequence AGGTTTACTGAAGAATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003253633_1003253642 12 Left 1003253633 6:4455534-4455556 CCCATGACCACCCTCCAGGGTTT No data
Right 1003253642 6:4455569-4455591 AGGTTTACTGAAGAATTTGAAGG No data
1003253637_1003253642 1 Left 1003253637 6:4455545-4455567 CCTCCAGGGTTTCCCAAGCACAG No data
Right 1003253642 6:4455569-4455591 AGGTTTACTGAAGAATTTGAAGG No data
1003253634_1003253642 11 Left 1003253634 6:4455535-4455557 CCATGACCACCCTCCAGGGTTTC No data
Right 1003253642 6:4455569-4455591 AGGTTTACTGAAGAATTTGAAGG No data
1003253638_1003253642 -2 Left 1003253638 6:4455548-4455570 CCAGGGTTTCCCAAGCACAGCAG No data
Right 1003253642 6:4455569-4455591 AGGTTTACTGAAGAATTTGAAGG No data
1003253636_1003253642 2 Left 1003253636 6:4455544-4455566 CCCTCCAGGGTTTCCCAAGCACA No data
Right 1003253642 6:4455569-4455591 AGGTTTACTGAAGAATTTGAAGG No data
1003253635_1003253642 5 Left 1003253635 6:4455541-4455563 CCACCCTCCAGGGTTTCCCAAGC No data
Right 1003253642 6:4455569-4455591 AGGTTTACTGAAGAATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003253642 Original CRISPR AGGTTTACTGAAGAATTTGA AGG Intergenic
No off target data available for this crispr