ID: 1003253643

View in Genome Browser
Species Human (GRCh38)
Location 6:4455578-4455600
Sequence GAAGAATTTGAAGGCCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003253634_1003253643 20 Left 1003253634 6:4455535-4455557 CCATGACCACCCTCCAGGGTTTC No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data
1003253641_1003253643 -3 Left 1003253641 6:4455558-4455580 CCAAGCACAGCAGGTTTACTGAA No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data
1003253638_1003253643 7 Left 1003253638 6:4455548-4455570 CCAGGGTTTCCCAAGCACAGCAG No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data
1003253640_1003253643 -2 Left 1003253640 6:4455557-4455579 CCCAAGCACAGCAGGTTTACTGA No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data
1003253637_1003253643 10 Left 1003253637 6:4455545-4455567 CCTCCAGGGTTTCCCAAGCACAG No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data
1003253635_1003253643 14 Left 1003253635 6:4455541-4455563 CCACCCTCCAGGGTTTCCCAAGC No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data
1003253636_1003253643 11 Left 1003253636 6:4455544-4455566 CCCTCCAGGGTTTCCCAAGCACA No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data
1003253633_1003253643 21 Left 1003253633 6:4455534-4455556 CCCATGACCACCCTCCAGGGTTT No data
Right 1003253643 6:4455578-4455600 GAAGAATTTGAAGGCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003253643 Original CRISPR GAAGAATTTGAAGGCCCTTT TGG Intergenic
No off target data available for this crispr