ID: 1003253749

View in Genome Browser
Species Human (GRCh38)
Location 6:4456636-4456658
Sequence TGCCCTTATAAAAGCGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003253749_1003253757 29 Left 1003253749 6:4456636-4456658 CCTTAAGCGCTTTTATAAGGGCA No data
Right 1003253757 6:4456688-4456710 ATGGCCTAATTACCTCCTGAAGG No data
1003253749_1003253750 -5 Left 1003253749 6:4456636-4456658 CCTTAAGCGCTTTTATAAGGGCA No data
Right 1003253750 6:4456654-4456676 GGGCATTAATCCCATCCTTGAGG No data
1003253749_1003253755 10 Left 1003253749 6:4456636-4456658 CCTTAAGCGCTTTTATAAGGGCA No data
Right 1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG No data
1003253749_1003253751 -4 Left 1003253749 6:4456636-4456658 CCTTAAGCGCTTTTATAAGGGCA No data
Right 1003253751 6:4456655-4456677 GGCATTAATCCCATCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003253749 Original CRISPR TGCCCTTATAAAAGCGCTTA AGG (reversed) Intergenic
No off target data available for this crispr