ID: 1003253755

View in Genome Browser
Species Human (GRCh38)
Location 6:4456669-4456691
Sequence CCTTGAGGGCAGAGCCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003253748_1003253755 11 Left 1003253748 6:4456635-4456657 CCCTTAAGCGCTTTTATAAGGGC No data
Right 1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG No data
1003253749_1003253755 10 Left 1003253749 6:4456636-4456658 CCTTAAGCGCTTTTATAAGGGCA No data
Right 1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003253755 Original CRISPR CCTTGAGGGCAGAGCCTTCA TGG Intergenic
No off target data available for this crispr