ID: 1003254291

View in Genome Browser
Species Human (GRCh38)
Location 6:4460645-4460667
Sequence GGTGATCAGACAGCAACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003254283_1003254291 28 Left 1003254283 6:4460594-4460616 CCAGCAGCACAGAGAGGAAATGA No data
Right 1003254291 6:4460645-4460667 GGTGATCAGACAGCAACCTCAGG No data
1003254288_1003254291 -9 Left 1003254288 6:4460631-4460653 CCCTTAGACTGCCTGGTGATCAG No data
Right 1003254291 6:4460645-4460667 GGTGATCAGACAGCAACCTCAGG No data
1003254289_1003254291 -10 Left 1003254289 6:4460632-4460654 CCTTAGACTGCCTGGTGATCAGA No data
Right 1003254291 6:4460645-4460667 GGTGATCAGACAGCAACCTCAGG No data
1003254282_1003254291 29 Left 1003254282 6:4460593-4460615 CCCAGCAGCACAGAGAGGAAATG No data
Right 1003254291 6:4460645-4460667 GGTGATCAGACAGCAACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003254291 Original CRISPR GGTGATCAGACAGCAACCTC AGG Intergenic
No off target data available for this crispr