ID: 1003254293

View in Genome Browser
Species Human (GRCh38)
Location 6:4460673-4460695
Sequence TGCTCATATTTATTTCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003254290_1003254293 8 Left 1003254290 6:4460642-4460664 CCTGGTGATCAGACAGCAACCTC No data
Right 1003254293 6:4460673-4460695 TGCTCATATTTATTTCTGTCAGG No data
1003254289_1003254293 18 Left 1003254289 6:4460632-4460654 CCTTAGACTGCCTGGTGATCAGA No data
Right 1003254293 6:4460673-4460695 TGCTCATATTTATTTCTGTCAGG No data
1003254288_1003254293 19 Left 1003254288 6:4460631-4460653 CCCTTAGACTGCCTGGTGATCAG No data
Right 1003254293 6:4460673-4460695 TGCTCATATTTATTTCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003254293 Original CRISPR TGCTCATATTTATTTCTGTC AGG Intergenic
No off target data available for this crispr