ID: 1003257393

View in Genome Browser
Species Human (GRCh38)
Location 6:4486460-4486482
Sequence TGGTCTCTAAAACTACTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003257393_1003257395 2 Left 1003257393 6:4486460-4486482 CCAAGAAGTAGTTTTAGAGACCA No data
Right 1003257395 6:4486485-4486507 TAATACGTCACTGCTGCTCCCGG No data
1003257393_1003257396 5 Left 1003257393 6:4486460-4486482 CCAAGAAGTAGTTTTAGAGACCA No data
Right 1003257396 6:4486488-4486510 TACGTCACTGCTGCTCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003257393 Original CRISPR TGGTCTCTAAAACTACTTCT TGG (reversed) Intergenic
No off target data available for this crispr