ID: 1003260144

View in Genome Browser
Species Human (GRCh38)
Location 6:4509636-4509658
Sequence CCATCATCTCCAAAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003260144_1003260150 -10 Left 1003260144 6:4509636-4509658 CCTGCCTTCTTTGGAGATGATGG No data
Right 1003260150 6:4509649-4509671 GAGATGATGGCAAATTTAGGGGG No data
1003260144_1003260151 -5 Left 1003260144 6:4509636-4509658 CCTGCCTTCTTTGGAGATGATGG No data
Right 1003260151 6:4509654-4509676 GATGGCAAATTTAGGGGGTGAGG No data
1003260144_1003260153 16 Left 1003260144 6:4509636-4509658 CCTGCCTTCTTTGGAGATGATGG No data
Right 1003260153 6:4509675-4509697 GGACAGTCACCCTGTCCTGAGGG No data
1003260144_1003260152 15 Left 1003260144 6:4509636-4509658 CCTGCCTTCTTTGGAGATGATGG No data
Right 1003260152 6:4509674-4509696 AGGACAGTCACCCTGTCCTGAGG No data
1003260144_1003260154 17 Left 1003260144 6:4509636-4509658 CCTGCCTTCTTTGGAGATGATGG No data
Right 1003260154 6:4509676-4509698 GACAGTCACCCTGTCCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003260144 Original CRISPR CCATCATCTCCAAAGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr