ID: 1003262974

View in Genome Browser
Species Human (GRCh38)
Location 6:4539830-4539852
Sequence CAGTGAAGCCATTTTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003262974_1003262979 4 Left 1003262974 6:4539830-4539852 CCAGCCCCAAAATGGCTTCACTG No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003262974 Original CRISPR CAGTGAAGCCATTTTGGGGC TGG (reversed) Intergenic