ID: 1003262979

View in Genome Browser
Species Human (GRCh38)
Location 6:4539857-4539879
Sequence ATCTTATCAAATATTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003262969_1003262979 23 Left 1003262969 6:4539811-4539833 CCTTCCCACAAAGAAAAACCCAG No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data
1003262977_1003262979 -1 Left 1003262977 6:4539835-4539857 CCCAAAATGGCTTCACTGGTGAA No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data
1003262974_1003262979 4 Left 1003262974 6:4539830-4539852 CCAGCCCCAAAATGGCTTCACTG No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data
1003262976_1003262979 0 Left 1003262976 6:4539834-4539856 CCCCAAAATGGCTTCACTGGTGA No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data
1003262978_1003262979 -2 Left 1003262978 6:4539836-4539858 CCAAAATGGCTTCACTGGTGAAT No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data
1003262973_1003262979 5 Left 1003262973 6:4539829-4539851 CCCAGCCCCAAAATGGCTTCACT No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data
1003262970_1003262979 19 Left 1003262970 6:4539815-4539837 CCCACAAAGAAAAACCCAGCCCC No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data
1003262971_1003262979 18 Left 1003262971 6:4539816-4539838 CCACAAAGAAAAACCCAGCCCCA No data
Right 1003262979 6:4539857-4539879 ATCTTATCAAATATTTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003262979 Original CRISPR ATCTTATCAAATATTTAAAT AGG Intergenic