ID: 1003270512

View in Genome Browser
Species Human (GRCh38)
Location 6:4603575-4603597
Sequence GGGACTTCCCCTGCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003270512_1003270517 5 Left 1003270512 6:4603575-4603597 CCAGTTTTTGCAGGGGAAGTCCC No data
Right 1003270517 6:4603603-4603625 TCAGGAAACCCCTCTATCTTGGG No data
1003270512_1003270516 4 Left 1003270512 6:4603575-4603597 CCAGTTTTTGCAGGGGAAGTCCC No data
Right 1003270516 6:4603602-4603624 CTCAGGAAACCCCTCTATCTTGG No data
1003270512_1003270521 30 Left 1003270512 6:4603575-4603597 CCAGTTTTTGCAGGGGAAGTCCC No data
Right 1003270521 6:4603628-4603650 AACCCAGATCTATTCCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003270512 Original CRISPR GGGACTTCCCCTGCAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr