ID: 1003271440

View in Genome Browser
Species Human (GRCh38)
Location 6:4611185-4611207
Sequence CTGTTCATAAGGAGAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003271435_1003271440 9 Left 1003271435 6:4611153-4611175 CCCAATCCTATGGGCTAACTTTG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG 0: 1
1: 0
2: 1
3: 30
4: 350
1003271436_1003271440 8 Left 1003271436 6:4611154-4611176 CCAATCCTATGGGCTAACTTTGA 0: 1
1: 0
2: 1
3: 22
4: 670
Right 1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG 0: 1
1: 0
2: 1
3: 30
4: 350
1003271437_1003271440 3 Left 1003271437 6:4611159-4611181 CCTATGGGCTAACTTTGAAAAGA 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG 0: 1
1: 0
2: 1
3: 30
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003271440 Original CRISPR CTGTTCATAAGGAGAGAGAA AGG Intergenic
901639846 1:10687650-10687672 CTGCTCAGGAGGAGAGAGAAAGG + Intronic
901976837 1:12951842-12951864 CTGTCCATTAGGAGTGAGCAGGG + Intronic
902008333 1:13249928-13249950 CTGTCCATTAGGAGTGAGCAGGG - Intergenic
902027301 1:13393695-13393717 CTGTCCATTAGGAGTGAGCAGGG - Intergenic
903401961 1:23060145-23060167 CTGAGCAGAATGAGAGAGAAAGG + Intronic
905467470 1:38166331-38166353 CTTTTCATAGGGAGGGAGAAGGG - Intergenic
905643302 1:39607084-39607106 AAGTTCCTAAGGACAGAGAAGGG - Intergenic
905772082 1:40644877-40644899 CTATTCAAAAGGACACAGAAAGG + Intronic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
908066992 1:60416730-60416752 CTGGTAATGAGGAAAGAGAAGGG + Intergenic
909292325 1:73899470-73899492 CTGATGATAAGAAGAGAAAAGGG - Intergenic
909377896 1:74961161-74961183 CTGTGCAGAAGCAGGGAGAAAGG - Intergenic
911231335 1:95364728-95364750 CTTTTCAAACTGAGAGAGAAGGG - Intergenic
912332180 1:108830103-108830125 CTCATCATAAGGAGAGAGTAGGG + Intronic
913467878 1:119161196-119161218 CTGTACATAATGAAAGAAAATGG - Intergenic
913540412 1:119814677-119814699 CTGAACATAAGGTGAGAGAGAGG - Intergenic
914745567 1:150498704-150498726 AGGTTCATAGGGAGAAAGAAAGG - Intronic
914811138 1:151029115-151029137 ATATTCATATAGAGAGAGAATGG - Intronic
916515648 1:165514040-165514062 ATGTTCATAAGGAGAGATCCAGG - Intergenic
917783465 1:178425892-178425914 CTGTTCTTAAGGAAAGAGAGAGG + Intronic
917923351 1:179769102-179769124 ATATTCAAAAGTAGAGAGAATGG - Intronic
918012613 1:180602098-180602120 CGGTTCATAAGGAGAGATATAGG + Intergenic
918112851 1:181472828-181472850 CTGTTCATGGGGAGGGAGAGTGG + Intronic
918790495 1:188820723-188820745 ATCTTCATAAGCAGAAAGAAGGG + Intergenic
920309573 1:205041025-205041047 CTGTTCCTGAGGAGAGAGTGGGG - Intergenic
920419878 1:205825814-205825836 ATATTCATAAGCAAAGAGAATGG - Intergenic
921271255 1:213472196-213472218 CTGTTCAGAGGGAGACACAATGG + Intergenic
921816983 1:219575223-219575245 CAGTTCATAAGCAGTGAAAATGG - Intergenic
921916373 1:220615407-220615429 CTGTTCATATATAAAGAGAAAGG - Intronic
922928215 1:229368292-229368314 GTGGTCATAAGGTGAGAGAAGGG + Intergenic
1062890229 10:1053937-1053959 CTGAGCAGAAGGAGAGAGATAGG + Intronic
1063104169 10:2978243-2978265 CAGTTCAAGAGGAGAGAGAGAGG - Intergenic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1063661672 10:8038400-8038422 CTTTTAAGAAGGAGAGAGAAAGG - Intergenic
1063889445 10:10614652-10614674 CTGTTGACAGGGAGAGAGATGGG + Intergenic
1064680829 10:17809429-17809451 CTGTCCATCAGGAGAAGGAAAGG + Exonic
1065177344 10:23091820-23091842 CTGTTTGTAAGTAGAGAGAGTGG + Intergenic
1066687170 10:37992310-37992332 CTGATCCTAAGGCCAGAGAAAGG - Intergenic
1067030464 10:42876076-42876098 CTGCTCATCAGACGAGAGAAAGG + Intergenic
1068087381 10:52391388-52391410 ATGTTCATAAGGAGTAAGAGTGG + Intergenic
1069012410 10:63388624-63388646 ATGTTAACAAGAAGAGAGAAAGG + Intronic
1069346460 10:67476391-67476413 CTGTTCTTATGCAGAGAGAGTGG + Intronic
1069390019 10:67925514-67925536 CTGTTCATGAATACAGAGAAAGG - Intronic
1069659082 10:70111742-70111764 CTTTTTAAAAGGAGAGAGGAGGG + Exonic
1071262621 10:83934436-83934458 CTCTTCATAAAGAAAGAGGAGGG + Intergenic
1071684835 10:87743725-87743747 CTGCTCATGAGGAAACAGAAAGG - Intronic
1072707824 10:97694733-97694755 CTGCTCTGAAAGAGAGAGAAAGG + Intergenic
1073148697 10:101297251-101297273 CTCTACATGGGGAGAGAGAAAGG - Intergenic
1073931831 10:108585327-108585349 GTCTTTATAAGGAGACAGAAAGG + Intergenic
1073935228 10:108623346-108623368 CTTTTATTAAGGAAAGAGAAAGG + Intergenic
1074400368 10:113136669-113136691 CTGTTTATAAAGAGATAAAAGGG + Intronic
1074605434 10:114959371-114959393 CTATCCATGAGTAGAGAGAATGG - Intronic
1074759694 10:116657921-116657943 GTGTTCATAAGTAGATAAAATGG + Intergenic
1076394786 10:130130555-130130577 ATGGTCATAGGGAGAGAGGATGG + Intergenic
1078192308 11:9101347-9101369 CTCTCCATAAGGTGGGAGAAAGG + Intronic
1078739626 11:14054382-14054404 CAGTTCTTAAGGAGAAAGAGGGG + Intronic
1079025758 11:16946391-16946413 CTGGTCATAGGGAGTGAGAAAGG - Intronic
1079881931 11:25939220-25939242 CTGTCCCAAAGGAGACAGAAGGG - Intergenic
1080251643 11:30240274-30240296 CTATTCGTAAGAAGAAAGAATGG - Intergenic
1081293621 11:41357779-41357801 ATTTTTATAAAGAGAGAGAATGG + Intronic
1082631097 11:55543250-55543272 TTGTTCCAAAGGAGAAAGAATGG - Intergenic
1084034501 11:66500717-66500739 CTGTTCATCAGGAGACATACAGG + Intronic
1084445774 11:69202722-69202744 TTGCACATCAGGAGAGAGAAAGG - Intergenic
1087225212 11:95591637-95591659 CAGTTCATATGGAGAGAGCCTGG + Intergenic
1090471786 11:126987397-126987419 CTGTTGATAATAAGAGTGAAAGG + Intronic
1091555344 12:1569306-1569328 CTGGTGAAAAGGAGAGGGAATGG - Intronic
1091591965 12:1847677-1847699 CTGTGTAAAAGCAGAGAGAATGG + Intronic
1091690911 12:2596853-2596875 CTTGTCAAAAGGACAGAGAATGG - Intronic
1092244138 12:6853626-6853648 CAGTTACTAAGGAGAGAGACAGG - Intronic
1092586495 12:9906259-9906281 CTTTTCATTGGGAGAGATAATGG + Intronic
1095411171 12:41924841-41924863 CTGTTCAGAAGAAAGGAGAAAGG + Intergenic
1095697198 12:45155963-45155985 ATATTCAGAAGGGGAGAGAATGG + Intergenic
1095861503 12:46922912-46922934 CTGTTGATAATAGGAGAGAAAGG + Intergenic
1095885805 12:47187263-47187285 GTGTTCATAGGGAGAGACCATGG + Intronic
1096607524 12:52777284-52777306 CTGTTCATAGTGAGAGAGCTTGG + Exonic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1097666577 12:62484354-62484376 CTATTCATAATGAAACAGAATGG + Intronic
1099627737 12:85096913-85096935 CAGTTCAAAAGGACAAAGAAGGG - Intronic
1099732927 12:86527180-86527202 TTGTACATAATGAGAGATAAGGG + Intronic
1100810151 12:98329813-98329835 TTCTTCACAAGGTGAGAGAAGGG + Intergenic
1102249496 12:111376581-111376603 CTGTTTAAAAAGAGAGAGAGAGG + Intergenic
1102784886 12:115596303-115596325 CTTTTCATAAGGAAACACAATGG - Intergenic
1103197212 12:119055102-119055124 CTCATCATAACAAGAGAGAACGG + Intronic
1107014947 13:35700815-35700837 ATGTTCAGAAGGAGAAAGAGAGG + Intergenic
1107151755 13:37119704-37119726 CTGTTAATCAGAAGAGATAAAGG - Intergenic
1107323003 13:39209483-39209505 CTGCACTTTAGGAGAGAGAAAGG + Intergenic
1109449183 13:62486448-62486470 TTTAGCATAAGGAGAGAGAAAGG - Intergenic
1109595287 13:64544987-64545009 AGGTTCTTAATGAGAGAGAATGG - Intergenic
1109668260 13:65567880-65567902 CTGTTGAGAAGAAGAGACAAAGG - Intergenic
1110798965 13:79672833-79672855 CTCTTAAAAAGTAGAGAGAAAGG - Intergenic
1112302093 13:98239855-98239877 CTGTGCTAGAGGAGAGAGAAAGG + Intronic
1112463824 13:99625839-99625861 CAGCTCCTAAGAAGAGAGAAGGG + Intronic
1112503511 13:99959533-99959555 GTGGTCAAAAGGAGCGAGAAGGG + Intergenic
1112532657 13:100220045-100220067 CTGTTCACAAGAAGTGAGGAAGG + Intronic
1113395003 13:109939282-109939304 CTGTTTAAAAGGCTAGAGAAAGG - Intergenic
1114711618 14:24784227-24784249 GTCTTCATAAGGATAGAAAATGG + Intergenic
1115845795 14:37531970-37531992 CTGTTCAAAAGGAGAGGAAGAGG + Intronic
1115873365 14:37832110-37832132 TTGTACATAAGGAGAGACAGGGG + Intronic
1115950928 14:38720342-38720364 ATGCACATATGGAGAGAGAATGG - Intergenic
1116300568 14:43176045-43176067 CTGTTCACAGAGAAAGAGAATGG - Intergenic
1117201103 14:53391056-53391078 CTGTTCATTAAGTGAAAGAATGG + Intergenic
1118216112 14:63809913-63809935 GCCTTGATAAGGAGAGAGAATGG - Intergenic
1119020747 14:71110592-71110614 GTGTTTATAAGGAAAGGGAAGGG - Exonic
1120381879 14:83790989-83791011 CTGTTCTGTAGGAGAGAGATAGG - Intergenic
1120689126 14:87573120-87573142 CAGTTCATCTGGTGAGAGAATGG - Intergenic
1123414135 15:20082776-20082798 ATGTTCAGAAGTAGAGAGAAGGG - Intergenic
1123523477 15:21089887-21089909 ATGTTCAGAAGTAGAGAGAAGGG - Intergenic
1123804104 15:23853853-23853875 CTGGTGATAAGGAGAAGGAAGGG + Intergenic
1124512567 15:30339658-30339680 ATGTTCATCAGGAGAGACCAAGG + Intergenic
1124730348 15:32191092-32191114 ATGTTCATCAGGAGAGACCAAGG - Intergenic
1124957561 15:34369308-34369330 ATGTTCATAAGGTGGGAGACAGG + Intergenic
1125839563 15:42786408-42786430 CTATTCCTGAGGAAAGAGAAAGG + Intronic
1126380238 15:48039003-48039025 ATATTCCTAAAGAGAGAGAAAGG + Intergenic
1128386901 15:67156049-67156071 CTGTTCAAAGGGAAAGAGATGGG + Intronic
1130006632 15:80105463-80105485 CAGTTCATCATGAGAGAGAGAGG - Intronic
1130430765 15:83844757-83844779 CTGTGCATGAAGAGAGATAATGG + Intronic
1130617993 15:85431029-85431051 CTGGTGATAATGAGAGATAAAGG + Intronic
1130638514 15:85647976-85647998 CTTTTCCTAAGTAAAGAGAAAGG - Intronic
1130745028 15:86643133-86643155 TTGTTCATAAAGAGAAAGATGGG + Intronic
1131088591 15:89600125-89600147 CAGTTCATCTGGAGAGAGCAAGG - Intronic
1133360855 16:5172736-5172758 ATATTCAAAAGTAGAGAGAATGG + Intergenic
1134823177 16:17263129-17263151 CTGATAACAAGGAAAGAGAAGGG - Intronic
1138723317 16:59107822-59107844 ATGATCACAAGGAGGGAGAATGG + Intergenic
1138988341 16:62359637-62359659 CTATTCAAAAGGAGAAAAAAGGG + Intergenic
1139095224 16:63697061-63697083 CTTTATATAAGGAGACAGAATGG - Intergenic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1141476872 16:84279965-84279987 CTGTTCTTGAGGAAAGGGAAAGG + Intergenic
1142389912 16:89792516-89792538 CTGTTCAGATGCAGAGAGAGTGG - Exonic
1142509068 17:383370-383392 CTGTTCATAAGGACACAGAGAGG - Intronic
1143328034 17:6113318-6113340 TTTTGCATAAGGAGAGAGATAGG - Intronic
1143421953 17:6800348-6800370 GTCTTCATGAGGAGAGAGGAAGG - Intronic
1146813387 17:35922651-35922673 CTTTTCATAAGGAATGATAATGG + Exonic
1146838417 17:36131672-36131694 CTGTTCATTGAGAAAGAGAAGGG - Intergenic
1147029961 17:37625291-37625313 CTGTTTATAAGAAGAAAGCAAGG - Intronic
1147899319 17:43773664-43773686 TTGTTCTTAAAGAGAGAGACTGG + Intronic
1149983492 17:61330136-61330158 CTTTTCATAGGCTGAGAGAAGGG + Intronic
1150182443 17:63138640-63138662 CTGATCATTAAGAAAGAGAAAGG - Intronic
1150969754 17:70014194-70014216 CAGTTCAAAAGGAGAAAGAAGGG + Intergenic
1151071296 17:71215723-71215745 CCGTGAAGAAGGAGAGAGAAAGG + Intergenic
1152362228 17:79837992-79838014 ATGTTCATAAAGACAGAGTAGGG - Intronic
1153079624 18:1207313-1207335 CTATTCCAAAAGAGAGAGAAAGG - Intergenic
1153416225 18:4849021-4849043 CTGTGCTTTAGGAGAGATAAAGG - Intergenic
1154936580 18:21064187-21064209 TGGTTTATAATGAGAGAGAAAGG - Intronic
1155315426 18:24566467-24566489 CTGTAGACGAGGAGAGAGAAAGG + Intergenic
1155419291 18:25637009-25637031 CCATTCATAATGAGAGAGAATGG + Intergenic
1157995696 18:52552505-52552527 CTGTTTATAAAGAAACAGAATGG + Intronic
1158848609 18:61471171-61471193 CTGTTCATGAGCAGAGAATAAGG - Intronic
1159002408 18:62986157-62986179 CTGTTCATAAGGAAGAAGTATGG - Intergenic
1159735028 18:72085724-72085746 CAGTTTATAAGGAAAGAGCAAGG + Intergenic
1159735145 18:72086936-72086958 CAGTTTATAAGGAAAGAGTAAGG + Intergenic
1162809216 19:13154146-13154168 CAGTCCAGAAGGAGAGCGAAAGG - Exonic
1164082951 19:21876301-21876323 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164190931 19:22916418-22916440 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164477940 19:28589702-28589724 CTGTTGAAAGGGAGAGAGATGGG - Intergenic
1165858800 19:38895770-38895792 CTATTTAAAAAGAGAGAGAAAGG + Intronic
1168060274 19:53888027-53888049 CTGTTAAAAAGGAGACAGCACGG - Intronic
925128727 2:1479430-1479452 CTGCTCCTGAGGAGACAGAAGGG - Intronic
925754923 2:7124118-7124140 ATGTTTATAATGAGAGAGAGAGG - Intergenic
926221796 2:10941231-10941253 GTTTTCATCAGGAGAAAGAAGGG + Intergenic
927019287 2:19000398-19000420 CTGATCATAAGGAGAAAGCATGG - Intergenic
927261457 2:21095371-21095393 CAGTTCTGAAGGAGAGAGGAGGG - Intergenic
928236450 2:29545796-29545818 GTGTTCATTAAGAGAGAGAAGGG + Intronic
928840256 2:35597707-35597729 TTGTTCAGAAGGTGAGAGAATGG - Intergenic
929322005 2:40555559-40555581 TTGTTCTTATGGAAAGAGAATGG + Intronic
931518342 2:63067950-63067972 CTGTTCATCTGGAGAAAGCAGGG + Intergenic
932886310 2:75552362-75552384 CTATTCATTAGGAGAGAGAAGGG - Intronic
933520132 2:83361113-83361135 CTGCTGATAAGGAGTGAGACTGG - Intergenic
934545570 2:95212170-95212192 CTATTCATAGGGAAAGAAAAAGG - Intronic
935341018 2:102059993-102060015 CTGATCATCACTAGAGAGAAAGG - Intergenic
936926803 2:117745371-117745393 CTGTGCATAGCGAGAGAGAGAGG - Intergenic
937308767 2:120888416-120888438 CTGTTCAAAAGGAGAGAATGTGG - Intronic
938636269 2:133230130-133230152 CTGATCATAATGAGAGAACATGG - Intronic
939956044 2:148528523-148528545 TTGATCAAAAGGGGAGAGAAAGG + Intergenic
940483810 2:154272464-154272486 CTGTTCATATGAGCAGAGAAGGG - Intronic
940896082 2:159082683-159082705 GTGTTCACTAGGAGACAGAAGGG + Intronic
941493158 2:166167445-166167467 CTGTTCATAAGTGGAGGAAAAGG - Intergenic
941535797 2:166721461-166721483 CTTTTCAGAGTGAGAGAGAAAGG + Intergenic
942503748 2:176619634-176619656 GTGTTCATAGCTAGAGAGAAAGG - Intergenic
943608754 2:190007320-190007342 CATTTCATAAAGTGAGAGAACGG - Intronic
944544305 2:200784043-200784065 CTGTTCACCAACAGAGAGAAGGG + Intergenic
945487236 2:210411032-210411054 CTGATAAGAAGGAGAGAGATGGG + Intergenic
945634209 2:212326855-212326877 CTGTCTGTAAGGATAGAGAATGG + Intronic
945908751 2:215622820-215622842 GTTTTCAGAAGGAGGGAGAAGGG + Intergenic
945920232 2:215748299-215748321 AAGTTCAGAGGGAGAGAGAAAGG - Intergenic
946762419 2:223007734-223007756 CTGCTCGTAAGGAAAGAGCAGGG - Intergenic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
947995193 2:234521684-234521706 CTGTTGACAAGGAGACAGAGTGG - Intergenic
948540241 2:238686100-238686122 GTGTTCATCAGGAGATAGATGGG - Intergenic
1169444450 20:5659703-5659725 CTGTTCTTAAAGGGAAAGAAGGG - Intergenic
1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG + Intergenic
1172789714 20:37494548-37494570 CTGTTCTTAAGCAGGGAGACAGG - Intronic
1173171240 20:40725737-40725759 CTGTCTTTAAGGAGAAAGAAGGG - Intergenic
1173763850 20:45588249-45588271 CTGTTCTCTAGAAGAGAGAAGGG + Intergenic
1173785417 20:45789594-45789616 CTGCAGATAACGAGAGAGAAAGG + Intronic
1174772556 20:53314575-53314597 CTGTTCGTAAGGAGATTGGAAGG - Intronic
1174915155 20:54645886-54645908 CTGTTCACTAGCAGAGAGCATGG + Intronic
1177421442 21:20862942-20862964 CAATACATGAGGAGAGAGAATGG + Intergenic
1177528947 21:22336317-22336339 CTGTGCATTAGGAAAGAGACTGG + Intergenic
1180695758 22:17750496-17750518 ATGTTTATAGAGAGAGAGAATGG + Intronic
1181742764 22:24934463-24934485 ATTTTCATAAGGGGTGAGAAAGG + Intergenic
1182545983 22:31076792-31076814 ATGTTCAGAAGTAGAGAGAAGGG + Intronic
1183360950 22:37383236-37383258 CTGTTCATGCGGTGAGAGTAAGG + Intronic
1183981488 22:41543103-41543125 CTGCTCTCAAGGAGAGGGAAAGG + Intronic
1184644426 22:45888532-45888554 CTATTCAAGAGGAGAGAGAGTGG - Intergenic
1185193037 22:49450871-49450893 TTTTTGATAAGGAGAGAGATAGG + Intronic
949128078 3:470409-470431 GGGTTCAGAAGAAGAGAGAATGG + Intergenic
949235751 3:1806482-1806504 CTGTTCTCAAGTAGAAAGAATGG + Intergenic
949738990 3:7208307-7208329 CTGGCCATAAGGAGACAGAAAGG + Intronic
950167736 3:10814544-10814566 CTGAATTTAAGGAGAGAGAAAGG + Intergenic
950373850 3:12554129-12554151 CTTTTCCTAAGGGGCGAGAACGG + Intronic
950590098 3:13930774-13930796 CTGTTCCTAATAAGAGAAAATGG - Intergenic
950710186 3:14808459-14808481 CTGTTCCTAATAAGAGAAAATGG - Intergenic
951061530 3:18212954-18212976 CTTTACATTAGAAGAGAGAAAGG + Intronic
951114650 3:18845763-18845785 CTGTGCATCAGGAGAGAAAGAGG - Intergenic
951521278 3:23612611-23612633 CTGTGAAAAAGGAGAGAGAGGGG + Intergenic
952160049 3:30684293-30684315 ATGTCCAAAATGAGAGAGAAGGG + Intronic
952404762 3:32995662-32995684 TTGTTTTTAAGGAGGGAGAAAGG - Intergenic
953327567 3:42025535-42025557 CTGTTCAAAGGGAGAGGGGAAGG + Intronic
953651197 3:44806526-44806548 CTGAGAATGAGGAGAGAGAAAGG + Intronic
953697651 3:45172383-45172405 CTGGTCATCAGGAGAAAGCAGGG - Intergenic
955412925 3:58667536-58667558 TGGGTCCTAAGGAGAGAGAAGGG - Intergenic
955547695 3:60048728-60048750 ATGTTCATCAGAAGAGTGAAAGG + Intronic
955592028 3:60547411-60547433 TTGTTTATAAAGAGAGAGTAGGG - Intronic
956009803 3:64818399-64818421 GTGGTTATCAGGAGAGAGAAGGG - Intergenic
956261954 3:67353427-67353449 GTTTTGATAAGGACAGAGAAGGG - Intergenic
957471909 3:80668945-80668967 CTGTTCAAAAGGGGAGATACTGG - Intergenic
959361307 3:105396281-105396303 ATGATCATAAGGAGAGAAATAGG + Intronic
960206949 3:114913754-114913776 TTGTATATAATGAGAGAGAAGGG + Intronic
960419158 3:117422446-117422468 CTGTTCATAAATAGAGATAGTGG - Intergenic
960524047 3:118689316-118689338 CTTTTAATAAGGACAAAGAAAGG + Intergenic
960697253 3:120408141-120408163 CTGTTCAAAAGCTGAGCGAATGG - Intronic
961173851 3:124818116-124818138 CTGTTCAGAAGGCGTGAAAAGGG + Intronic
961203250 3:125061005-125061027 CCATTCACAAGGAGAGGGAACGG + Intergenic
962167483 3:133064371-133064393 CTGTCCACAAGGAGACAGTAAGG - Intronic
962864204 3:139433977-139433999 CTGGTCCTAAGGAGAGTGAGAGG + Intergenic
964517671 3:157530540-157530562 CAACTCACAAGGAGAGAGAAGGG + Intronic
966339819 3:178913268-178913290 TTGTTCAAAAGGACAGAGCATGG + Intergenic
966888263 3:184388564-184388586 CTGTTGAGAGGGAAAGAGAAAGG - Intronic
968881971 4:3305604-3305626 CTGTTCAAAATGAGGGAAAATGG + Intronic
968903294 4:3440906-3440928 CTGTGCAGAGGGAGAGAGAATGG - Intergenic
968917345 4:3502342-3502364 CTGTTCACAAAGTGGGAGAAAGG + Intergenic
969275438 4:6132312-6132334 ATGTTCAGAAGGACAGAGCATGG + Intronic
970606479 4:17686504-17686526 CTGCTCTTATGGAGAGAGGAGGG + Intronic
971839243 4:31812103-31812125 ATGTTCATAAAGAAACAGAAAGG - Intergenic
972316429 4:37930951-37930973 CCATTCATATGGAGAAAGAATGG + Intronic
972657217 4:41076061-41076083 AAGTTCATGAGAAGAGAGAATGG + Intronic
973793175 4:54396804-54396826 CTGTTCTGAAGGAGACAGAGAGG + Intergenic
974652772 4:64776720-64776742 GTGTGCACAGGGAGAGAGAAAGG - Intergenic
974712288 4:65614263-65614285 GTGTTGATAAGCAGAGAAAAAGG - Intronic
975249169 4:72157368-72157390 CTGCTCAAAAGGAGAGAAAATGG - Intergenic
975698528 4:77039105-77039127 ATGTCCATTAGGAGAGAGTAGGG - Intronic
976831953 4:89325106-89325128 CTCTTCACAAGTAGAAAGAAAGG + Intergenic
977732405 4:100369469-100369491 TTGCTCATAAGGAAATAGAATGG - Intergenic
977736766 4:100426437-100426459 ATGGTGATAGGGAGAGAGAACGG - Intronic
977751542 4:100615208-100615230 GTGTTCTTAAGGAAAGAAAAAGG - Intronic
978082897 4:104616368-104616390 CTCTGCTTAAGGAGAGAGGAGGG - Intergenic
978350740 4:107818246-107818268 CTGGGCATAAGCACAGAGAATGG - Intergenic
978904760 4:113993118-113993140 CCTTTATTAAGGAGAGAGAAAGG - Intergenic
979840285 4:125430710-125430732 CTGATAATAAGGGGAGAAAAGGG + Intronic
980009364 4:127579185-127579207 CTGCTCCTACGGAGAGACAACGG + Intergenic
980255000 4:130368223-130368245 CTCTGTATAAAGAGAGAGAATGG + Intergenic
980806475 4:137821272-137821294 CTAATGAGAAGGAGAGAGAAGGG - Intergenic
981256691 4:142669627-142669649 TTGTTTATGATGAGAGAGAAAGG - Intronic
981543337 4:145868794-145868816 CTGACCATAAGGAGGGAGACAGG + Intronic
981866677 4:149429242-149429264 CAGTGCATAAGGAAAGACAACGG + Intergenic
982201392 4:152964462-152964484 CTGTTCAGGAGGTGAGAGGAAGG - Intronic
982463607 4:155702621-155702643 CTGTTCAGATATAGAGAGAAAGG - Intronic
982469540 4:155771314-155771336 ATTTTAATAAAGAGAGAGAAAGG + Intronic
983499525 4:168483222-168483244 CTGTTCACAAAGGGAGAAAATGG - Intronic
983738253 4:171090935-171090957 CTGTTCATAAAGAGAGATGTAGG - Intergenic
983952590 4:173660322-173660344 CTGTTCATAATGAGACCAAATGG - Intergenic
985108587 4:186523635-186523657 CAGATCACAAGGGGAGAGAATGG - Intronic
985371238 4:189287065-189287087 CTATTCTAAAGGAGAGAAAAAGG + Intergenic
986013928 5:3740944-3740966 CTGTTCAGGAGAAGAGGGAAAGG + Intergenic
986082125 5:4405806-4405828 TTGTTGATAAGGAGACAGCAGGG - Intergenic
986987436 5:13515126-13515148 CTGTTCAAAATGAGAGAAATTGG - Intergenic
987074826 5:14371379-14371401 ATGTACAAAAGGAGAGAGAATGG + Intronic
987216505 5:15743332-15743354 CTGTTCCAAATGAGAGAAAATGG + Intronic
987970413 5:24936864-24936886 CTGTTAAAAAGGAAAGAAAAAGG + Intergenic
988006038 5:25412030-25412052 CTGTTCAATAGAAAAGAGAAAGG - Intergenic
989596933 5:43164953-43164975 CTGTTTCAAAGGAGAGAGAGAGG - Intronic
990649838 5:57885884-57885906 CTCTTTTTAAGGAGGGAGAAGGG - Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
991377952 5:65985882-65985904 CTGTTAATAAGGACTTAGAATGG - Intronic
997361683 5:133299297-133299319 ATGGACATAAGGAGAGAGACTGG - Intronic
998077115 5:139246050-139246072 TTGTTCAGAAGCAGAGAGAAAGG + Intronic
998174123 5:139890963-139890985 CAGTTCATAAGAAAGGAGAAGGG - Intronic
998350813 5:141499511-141499533 ATGTACAAAAGTAGAGAGAATGG + Intronic
999071438 5:148747803-148747825 GGGTTCCTAAGGAGAGAGAAGGG + Intergenic
999084304 5:148873596-148873618 CTGTTGATGAGGAAAGAAAATGG + Intergenic
999250977 5:150182161-150182183 CTGTGCAAGAGAAGAGAGAAGGG - Intronic
1002367512 5:178724719-178724741 GTGCACATAAGCAGAGAGAAAGG - Intronic
1002385985 5:178867742-178867764 GTGCACATAAGCAGAGAGAAAGG + Intronic
1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG + Intergenic
1003631888 6:7794839-7794861 CTGCTCATAAGAAGAGAACATGG + Intronic
1003633737 6:7812009-7812031 GTGTTCAAATGGAGAGAGCAGGG + Intronic
1004535353 6:16495402-16495424 CTGTTCAAAAGGACAGAGGTTGG - Intronic
1005100252 6:22164960-22164982 CTGTACATAGGGAGAGATAGGGG + Intergenic
1005717438 6:28564150-28564172 CTGCTCCTAAGGAGAGAACAGGG - Intergenic
1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG + Exonic
1007205068 6:40142980-40143002 CTTTTCATAATGAAAGAGTAGGG + Intergenic
1007283831 6:40732976-40732998 CTGTTCATGAGAATAGAAAATGG + Intergenic
1008530569 6:52454230-52454252 CGGTTCATTAGGAGTGGGAAAGG - Exonic
1009311847 6:62163783-62163805 GTGTTCTAAAGGAGAGAGTAAGG - Intronic
1009439398 6:63658754-63658776 GTGTTTATAACGAGAGAGAGAGG + Intronic
1009608070 6:65899598-65899620 CTATTCAAAAGAAGGGAGAATGG + Intergenic
1009726497 6:67542509-67542531 CTGTGCTTTAGGAAAGAGAATGG + Intergenic
1012008423 6:93747200-93747222 TTGTTCGTAAGGAGAAAGTAGGG + Intergenic
1012069361 6:94593041-94593063 CTGATAATAGGGAGAGAGAATGG + Intergenic
1012171933 6:96027387-96027409 CTGTGCATCAGGGCAGAGAAAGG - Intronic
1014327117 6:120012297-120012319 CTGTTCCTAAAGGGAGAAAACGG + Intergenic
1016043926 6:139461950-139461972 GTGTTCAGATGGAGAGAGAAAGG - Intergenic
1016324406 6:142883180-142883202 CTCTGCACATGGAGAGAGAAAGG + Intronic
1017587918 6:155947247-155947269 CTGTCCATAAGGAGAGGCACCGG - Intergenic
1018282606 6:162203783-162203805 GAGTTGATTAGGAGAGAGAAAGG - Intronic
1019224288 6:170497524-170497546 CTGTTAAAAAGGAGGGATAATGG - Intergenic
1020154970 7:5715584-5715606 CTTGTCATAAGGAGTGTGAATGG + Intronic
1021602868 7:22381479-22381501 ATATTCATAAAGAGATAGAAAGG - Intergenic
1024112394 7:46160557-46160579 TTGTTCTTAAGGAGTGAGAGGGG - Intergenic
1027027046 7:74860491-74860513 CTGTTCTTAATGAGAGCAAATGG + Intergenic
1027060706 7:75083613-75083635 CTGTTCTTAATGAGAGCAAATGG - Intergenic
1027217902 7:76196021-76196043 CTGTTCAGAGGGAGAGTGACTGG + Intergenic
1027876756 7:83780344-83780366 CTATTCATAAAGGGGGAGAATGG + Intergenic
1027981210 7:85225330-85225352 TTGTTCATGAAGAGAGAGAGAGG - Intergenic
1030204138 7:106936412-106936434 ATGTTCATATAGAAAGAGAAAGG + Intergenic
1030711073 7:112749881-112749903 CTGACAATAAGTAGAGAGAATGG + Intergenic
1031009707 7:116513043-116513065 CAGATCCTAAGGAGAAAGAAAGG - Intergenic
1033398803 7:141001442-141001464 ATTTTCACAAGCAGAGAGAAAGG - Intergenic
1033649443 7:143329660-143329682 CTGTTCACATGGAGAGAAAGGGG + Intronic
1033904875 7:146190821-146190843 CTGTTTAGAAAGAGAGAGAAGGG - Intronic
1034094399 7:148393245-148393267 CTTAGCATAAGGAGAGAAAAGGG - Intronic
1035762767 8:2081459-2081481 CTGCTCGTGAGGAGTGAGAAGGG - Intronic
1035928922 8:3759993-3760015 CTGGACATCAGGAGAGAAAATGG - Intronic
1035936599 8:3847895-3847917 TTATTTATAAGGAGAGAAAACGG - Intronic
1037680185 8:21090651-21090673 GAGTTCATAATTAGAGAGAAAGG - Intergenic
1037684902 8:21130383-21130405 CTCTTTAGCAGGAGAGAGAATGG + Intergenic
1038280370 8:26158823-26158845 CTGTTCCAAAGGAGAGAAATTGG + Intergenic
1038329000 8:26592919-26592941 CACTTCTTAAGAAGAGAGAAAGG - Intronic
1039017378 8:33166684-33166706 CTATTAATTAGGAAAGAGAATGG - Intergenic
1039547832 8:38422404-38422426 CTCTTAAAAAAGAGAGAGAAGGG - Intronic
1039567700 8:38563413-38563435 CTGTTCACAAAGGCAGAGAAGGG - Intergenic
1039709144 8:40037919-40037941 CTGTTCAAAAGAGGAGAGATGGG + Intergenic
1040803170 8:51365965-51365987 CTGTTCACAGGGGGAGAAAATGG - Intronic
1041178431 8:55221873-55221895 CAGTTCATGAGGAAAGAGGAGGG + Intronic
1041280083 8:56199890-56199912 ATGAGCAAAAGGAGAGAGAATGG + Intronic
1041680156 8:60580731-60580753 CAGTTCAGAAGGAATGAGAATGG + Intronic
1041714844 8:60923556-60923578 ATGCACAAAAGGAGAGAGAAAGG + Intergenic
1042570167 8:70155356-70155378 CTGATCTTAAAAAGAGAGAAAGG + Intronic
1042903382 8:73749144-73749166 TTGTTCACCAGGCGAGAGAAGGG - Intronic
1044089268 8:87979012-87979034 CTTTTCATAAGCAGAATGAATGG + Intergenic
1044218744 8:89645245-89645267 CTGCAAATAAGGAGAGACAATGG + Intergenic
1044350578 8:91160601-91160623 ATGGTCAGCAGGAGAGAGAAGGG - Intronic
1045149121 8:99383254-99383276 ATGTTCAAAAGCAAAGAGAAAGG - Intronic
1045748602 8:105454753-105454775 CTGTTCATAAAGAAAGGGGAGGG + Intronic
1046955576 8:120059785-120059807 CTGTTCATAAGGCGGCAGGAGGG - Intronic
1047060312 8:121218426-121218448 CAGGGCATCAGGAGAGAGAATGG + Intergenic
1047229042 8:122980304-122980326 CAGTCCTTAAGTAGAGAGAATGG + Intergenic
1048397152 8:134024629-134024651 ATTTTCATCAGGAGAGAGAAGGG - Intergenic
1049068994 8:140342525-140342547 TTGTTCAGAACTAGAGAGAAGGG - Intronic
1050795499 9:9535761-9535783 CTGTTCTTAATGACATAGAAAGG - Intronic
1050849387 9:10264533-10264555 CTGTTCCAAATGGGAGAGAATGG - Intronic
1051797906 9:20895301-20895323 ATGTTCATATGAAGAGACAAAGG - Intronic
1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG + Intergenic
1056021621 9:82443867-82443889 TTAGTCACAAGGAGAGAGAAGGG + Intergenic
1059508581 9:114822681-114822703 CTGCTAATGGGGAGAGAGAAGGG + Intergenic
1060543503 9:124447357-124447379 CTATTCCTAAGCAGAGGGAATGG + Intergenic
1060728695 9:126023392-126023414 CTGCTCACAAGGGGAGAGGAGGG - Intergenic
1060970115 9:127732982-127733004 CTGTTCAGAAGCAGAGACAGAGG + Intronic
1061251857 9:129431167-129431189 CTCTTCCTAAGGATACAGAATGG - Intergenic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1062293209 9:135807177-135807199 CTTTCCACAATGAGAGAGAAAGG + Intergenic
1062710719 9:137973802-137973824 CTGTTCCTAGGGAGAGTGAGAGG + Intronic
1186123974 X:6392761-6392783 CCTGTCCTAAGGAGAGAGAATGG + Intergenic
1186541689 X:10407757-10407779 CTGTTTATTCAGAGAGAGAACGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1189382454 X:40511544-40511566 CTGGTCATAAAGAGAGAGGGAGG + Intergenic
1191887035 X:65899339-65899361 CTGTTCCTAATGAGAGAAACTGG + Intergenic
1192864662 X:75117905-75117927 CAGTTCACACAGAGAGAGAAAGG - Intronic
1195572738 X:106414608-106414630 CTGTTCATACAGAGATTGAATGG + Intergenic
1196322605 X:114359779-114359801 CTGTTCAGAATGAGAGATAATGG - Intergenic
1196969356 X:121092016-121092038 CTGTTCAAAAAGAGAGAGCAGGG - Intergenic
1197156533 X:123276017-123276039 CTTTTCATATGGAGAAATAATGG - Intronic