ID: 1003271529

View in Genome Browser
Species Human (GRCh38)
Location 6:4611825-4611847
Sequence TGCTCTCTTGGGAGCACGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003271529_1003271535 12 Left 1003271529 6:4611825-4611847 CCACCCGTGCTCCCAAGAGAGCA No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271529_1003271534 -2 Left 1003271529 6:4611825-4611847 CCACCCGTGCTCCCAAGAGAGCA No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003271529 Original CRISPR TGCTCTCTTGGGAGCACGGG TGG (reversed) Intergenic
No off target data available for this crispr