ID: 1003271534

View in Genome Browser
Species Human (GRCh38)
Location 6:4611846-4611868
Sequence CAATTCATCATGTCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003271526_1003271534 9 Left 1003271526 6:4611814-4611836 CCCAGTCTCACCCACCCGTGCTC No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271531_1003271534 -6 Left 1003271531 6:4611829-4611851 CCGTGCTCCCAAGAGAGCAATTC No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271524_1003271534 13 Left 1003271524 6:4611810-4611832 CCTCCCCAGTCTCACCCACCCGT No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271530_1003271534 -5 Left 1003271530 6:4611828-4611850 CCCGTGCTCCCAAGAGAGCAATT No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271525_1003271534 10 Left 1003271525 6:4611813-4611835 CCCCAGTCTCACCCACCCGTGCT No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271529_1003271534 -2 Left 1003271529 6:4611825-4611847 CCACCCGTGCTCCCAAGAGAGCA No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271523_1003271534 16 Left 1003271523 6:4611807-4611829 CCTCCTCCCCAGTCTCACCCACC No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271522_1003271534 20 Left 1003271522 6:4611803-4611825 CCATCCTCCTCCCCAGTCTCACC No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271521_1003271534 21 Left 1003271521 6:4611802-4611824 CCCATCCTCCTCCCCAGTCTCAC No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271528_1003271534 -1 Left 1003271528 6:4611824-4611846 CCCACCCGTGCTCCCAAGAGAGC No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data
1003271527_1003271534 8 Left 1003271527 6:4611815-4611837 CCAGTCTCACCCACCCGTGCTCC No data
Right 1003271534 6:4611846-4611868 CAATTCATCATGTCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003271534 Original CRISPR CAATTCATCATGTCAGTGTC TGG Intergenic
No off target data available for this crispr