ID: 1003271535

View in Genome Browser
Species Human (GRCh38)
Location 6:4611860-4611882
Sequence AGTGTCTGGTGTTTTCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003271527_1003271535 22 Left 1003271527 6:4611815-4611837 CCAGTCTCACCCACCCGTGCTCC No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271525_1003271535 24 Left 1003271525 6:4611813-4611835 CCCCAGTCTCACCCACCCGTGCT No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271532_1003271535 1 Left 1003271532 6:4611836-4611858 CCCAAGAGAGCAATTCATCATGT No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271529_1003271535 12 Left 1003271529 6:4611825-4611847 CCACCCGTGCTCCCAAGAGAGCA No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271528_1003271535 13 Left 1003271528 6:4611824-4611846 CCCACCCGTGCTCCCAAGAGAGC No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271524_1003271535 27 Left 1003271524 6:4611810-4611832 CCTCCCCAGTCTCACCCACCCGT No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271530_1003271535 9 Left 1003271530 6:4611828-4611850 CCCGTGCTCCCAAGAGAGCAATT No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271526_1003271535 23 Left 1003271526 6:4611814-4611836 CCCAGTCTCACCCACCCGTGCTC No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271531_1003271535 8 Left 1003271531 6:4611829-4611851 CCGTGCTCCCAAGAGAGCAATTC No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271533_1003271535 0 Left 1003271533 6:4611837-4611859 CCAAGAGAGCAATTCATCATGTC No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data
1003271523_1003271535 30 Left 1003271523 6:4611807-4611829 CCTCCTCCCCAGTCTCACCCACC No data
Right 1003271535 6:4611860-4611882 AGTGTCTGGTGTTTTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003271535 Original CRISPR AGTGTCTGGTGTTTTCTTGA AGG Intergenic
No off target data available for this crispr