ID: 1003272225

View in Genome Browser
Species Human (GRCh38)
Location 6:4617346-4617368
Sequence CTACAGTTCTTGAGAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003272225_1003272231 27 Left 1003272225 6:4617346-4617368 CCTCCTTCTCTCAAGAACTGTAG No data
Right 1003272231 6:4617396-4617418 AGAAGCAACATTCAGGCTTTAGG No data
1003272225_1003272230 20 Left 1003272225 6:4617346-4617368 CCTCCTTCTCTCAAGAACTGTAG No data
Right 1003272230 6:4617389-4617411 ACTCAGCAGAAGCAACATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003272225 Original CRISPR CTACAGTTCTTGAGAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr