ID: 1003286051

View in Genome Browser
Species Human (GRCh38)
Location 6:4734681-4734703
Sequence GGATGGGGATGGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003286036_1003286051 18 Left 1003286036 6:4734640-4734662 CCTAATTCAGGAAGGGGAGGGCA 0: 1
1: 0
2: 0
3: 11
4: 224
Right 1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003286051 Original CRISPR GGATGGGGATGGAGGGAAGA TGG Intronic
No off target data available for this crispr