ID: 1003289944

View in Genome Browser
Species Human (GRCh38)
Location 6:4771743-4771765
Sequence AGGTAAAGACGATACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003289939_1003289944 23 Left 1003289939 6:4771697-4771719 CCTAGTTGTTCTCTCTCTCTCTT 0: 2
1: 4
2: 29
3: 312
4: 2058
Right 1003289944 6:4771743-4771765 AGGTAAAGACGATACTGGGATGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003289944 Original CRISPR AGGTAAAGACGATACTGGGA TGG Intronic
900752765 1:4409203-4409225 AGGGAAAGAACATTCTGGGAAGG - Intergenic
902556531 1:17250162-17250184 AGGTAATCAGGATACTGGGAGGG + Intronic
902890234 1:19438050-19438072 AGGTAAGAACAATACTTGGATGG - Intronic
902995861 1:20224159-20224181 AGGGAAAGAGGAGAATGGGAAGG - Intergenic
910369031 1:86496624-86496646 AAGTAAAGATGACAGTGGGAAGG - Intronic
910558027 1:88558363-88558385 AGGTACAGAGGATACTGCAATGG - Intergenic
915880007 1:159659576-159659598 AGGTAAAGAACATACAGGGAAGG - Intergenic
915955481 1:160217064-160217086 AGGAAAATAGGATTCTGGGATGG + Exonic
916528374 1:165632165-165632187 AGGAAAAGCAGATACTAGGATGG + Intronic
920111668 1:203591512-203591534 AGGAAAAGAGGATAGTGGAAAGG + Intergenic
920557672 1:206915959-206915981 AGGTAAAAACAATCATGGGAGGG + Intronic
921577641 1:216855564-216855586 ATGTAAAGATGATACTGTCAAGG + Intronic
923369592 1:233296696-233296718 AGGTAAGGATGATGCAGGGAAGG - Intergenic
1072200068 10:93150269-93150291 ATGTAAAGAAGAGATTGGGAGGG + Intergenic
1073299562 10:102462582-102462604 AGGTAAAGACTAGAAAGGGATGG - Intronic
1073375540 10:103031001-103031023 AGGTTTAGATGAGACTGGGATGG + Intronic
1073719413 10:106149809-106149831 AGCTAAAGAAGAAAATGGGAAGG + Intergenic
1074204680 10:111272352-111272374 AGGAAAAGAGGAGAGTGGGAGGG + Intergenic
1079141489 11:17813179-17813201 AGGTAGACAGGATACTGGTATGG - Intronic
1079604256 11:22344582-22344604 AAGTAAAGACGATACTCGAAAGG - Intronic
1080047210 11:27821479-27821501 AGGGAAAGACAAGACTGGCAGGG + Intergenic
1082832504 11:57629351-57629373 GGGTAAAGATGATCCTGTGATGG + Intergenic
1082837363 11:57661156-57661178 AGGTAAACAGGAGTCTGGGATGG - Exonic
1086399573 11:86449491-86449513 AGATAAGGAGGAAACTGGGAAGG + Intronic
1088788395 11:113202894-113202916 AGGTAAATAGAATACTGGTATGG + Intronic
1089534748 11:119154142-119154164 AGGTAAGGAAGAGACTGGGGTGG + Exonic
1093193331 12:16100603-16100625 AGGTAGAGATGATATTGAGAAGG - Intergenic
1105879178 13:24588632-24588654 AGAAAAAGACAATTCTGGGAAGG - Intergenic
1105920660 13:24960417-24960439 AGAAAAAGACAATTCTGGGAAGG + Intergenic
1108886812 13:55195978-55196000 AGGTAAAGACATTACAAGGAAGG - Intergenic
1110069117 13:71151068-71151090 AGGAAAAGATTATAGTGGGAAGG + Intergenic
1111648554 13:91062270-91062292 AGGAAAAGACAATTTTGGGAAGG + Intergenic
1113160250 13:107371927-107371949 ATGTATATACGATTCTGGGATGG - Intronic
1118325376 14:64777018-64777040 AGGAAAAGACAACAGTGGGATGG + Intronic
1118916220 14:70108862-70108884 GGGTAAAGAAGATCCTGGTAAGG - Intronic
1122907802 14:104810278-104810300 AGGGAAGGGCGCTACTGGGAGGG - Intergenic
1125520838 15:40347077-40347099 AGGTACAGACCAGACTGGGGAGG + Intergenic
1126711441 15:51461328-51461350 AGGGCAAGACGAGAATGGGAGGG + Intronic
1128054763 15:64691413-64691435 AGGTAAGGAGGACCCTGGGATGG - Exonic
1130282296 15:82529992-82530014 AGGTAAAGAGGTGACTGGGAAGG - Intergenic
1133676690 16:8079918-8079940 AGCGAAAGACATTACTGGGAGGG + Intergenic
1139190597 16:64858613-64858635 AGGTAAAGAAGATGCATGGAAGG + Intergenic
1141207741 16:81946440-81946462 AGGAAAGGAGGATGCTGGGAGGG - Intronic
1150522438 17:65883188-65883210 AGCAAAAGAAGATGCTGGGAAGG + Intronic
1155614339 18:27703493-27703515 AAGTAAGGACTAAACTGGGAAGG - Intergenic
1157707493 18:49819617-49819639 AGGATAAGATGATACTGTGACGG - Intronic
1160076248 18:75680439-75680461 AGGTAATGCCGCTGCTGGGAGGG - Intergenic
1161604647 19:5207901-5207923 AGGTAAAGATGGGACAGGGAGGG - Exonic
1164744143 19:30599067-30599089 AGGGAAAGAGGAAACAGGGAGGG - Intronic
925865354 2:8221932-8221954 AGCTACAGAGGATTCTGGGAGGG + Intergenic
929137506 2:38638728-38638750 AGGTATAGATGATAGTGGGTGGG - Intergenic
929689816 2:44064893-44064915 AGGGAAAGAGGGAACTGGGAGGG - Intergenic
937459349 2:122072150-122072172 AGGGAAAGAAGATTCTGGAATGG - Intergenic
940053580 2:149490005-149490027 AGGAAAAGACGAGGGTGGGACGG - Intergenic
940413241 2:153390510-153390532 ATGTAAAGATGATATTTGGATGG - Intergenic
941885891 2:170527047-170527069 AGGTAAAGACAGGACTGGCAAGG - Intronic
942165948 2:173241100-173241122 AGGGCAAGAGGATGCTGGGATGG + Intronic
942963521 2:181861597-181861619 AGGTAGAGACAAGGCTGGGAGGG - Intergenic
948444726 2:238023529-238023551 AGTTAAAGAGGATATTTGGATGG + Intronic
1175484359 20:59334659-59334681 AGGGAAAGACGGGACTGTGAAGG + Intergenic
1175557834 20:59884646-59884668 TGGTAAAAATCATACTGGGAAGG - Intronic
1176511970 21:7755589-7755611 GGGTTAAGACCAGACTGGGAAGG - Intronic
1178646083 21:34386115-34386137 GGGTTAAGACCAGACTGGGAAGG - Intronic
1178900770 21:36596735-36596757 ATGTAAAGACTTTACTTGGATGG + Intergenic
950854352 3:16091511-16091533 GGGTAAAGAGGAGACAGGGAAGG + Intergenic
952406876 3:33013074-33013096 AGGTAGAGACTAGATTGGGACGG - Intronic
957862044 3:85966020-85966042 AGGTAAAAGAGACACTGGGAAGG - Intronic
964089419 3:152857000-152857022 AGGTAAGGAAGATGCAGGGAGGG + Intergenic
965776031 3:172232174-172232196 AATTAAAGACCATACTGGCAGGG - Intronic
965862768 3:173167101-173167123 AGGTAAAGATGAAACAGGGGTGG + Intergenic
970348810 4:15180474-15180496 ATGTAAAGAGGTTACTTGGAGGG + Intergenic
972235698 4:37131365-37131387 AGGTAGAGACGAGGCTGGAAGGG + Intergenic
972407520 4:38761176-38761198 AGGGAAAGAACCTACTGGGAAGG - Intergenic
973655987 4:53048418-53048440 AGGTCAAGACAATACTGCAAAGG - Intronic
976382891 4:84420335-84420357 AGATAAAAAGAATACTGGGAAGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979809819 4:125022394-125022416 AGACAAAGACGATACTGGTAGGG - Intergenic
984488720 4:180405058-180405080 AGGTAAAAAGGACACTGGGAAGG + Intergenic
984922449 4:184777726-184777748 AGCTACAGATGCTACTGGGAGGG + Intronic
988527529 5:32000009-32000031 GGCTAAAGAGGATACTGTGATGG - Intronic
989342299 5:40389513-40389535 ATGTAAGGACAATACTGGGGAGG + Intergenic
994267954 5:97739854-97739876 AGGAAAAGAGGTTACTGGTAGGG - Intergenic
995473427 5:112525871-112525893 AGGCTAAGACGGTACTGTGAGGG + Intergenic
1003289944 6:4771743-4771765 AGGTAAAGACGATACTGGGATGG + Intronic
1004714225 6:18201686-18201708 AGGTAACAACGAAACTGAGATGG - Intronic
1005486540 6:26305694-26305716 AACTAAAGAGGAGACTGGGAGGG + Intergenic
1008766128 6:54917434-54917456 ATGTAAAGAAGACATTGGGAAGG - Intronic
1012149525 6:95729744-95729766 TGTTAAATACGATAATGGGAAGG - Intergenic
1012768080 6:103395274-103395296 AGGTCAAGACACTACTGAGAGGG - Intergenic
1017954251 6:159165308-159165330 AGGTCAAGGCGAAACTGAGATGG + Intergenic
1018613316 6:165662958-165662980 ATGTGAAGACTAGACTGGGAGGG - Intronic
1019816920 7:3208103-3208125 AGATAAAGATGATACTGGCTGGG + Intergenic
1020110849 7:5446945-5446967 TGCTAAAGAGGATACAGGGAGGG + Intronic
1020268947 7:6580677-6580699 AGGTAAGGATGATCCTTGGATGG + Exonic
1020629050 7:10618577-10618599 AGATAAAGAAGATTCTGGTAAGG - Intergenic
1024756030 7:52532481-52532503 AGGTAAAGAGGAATTTGGGAGGG - Intergenic
1031453988 7:121957128-121957150 GGGAAAAGATGATACTGGCAAGG - Intronic
1034826204 7:154266029-154266051 AGGTCAAGTCCATAATGGGAGGG - Intronic
1034848164 7:154467012-154467034 AGGTAAACACAGTAGTGGGACGG + Intronic
1037576173 8:20205458-20205480 TGTGAAAGATGATACTGGGAAGG + Intronic
1039222145 8:35344098-35344120 AGGAAAAGACAATTCTGGGTTGG + Intronic
1044062420 8:87654377-87654399 AGATACAGAATATACTGGGAAGG + Intergenic
1044515617 8:93134916-93134938 AGGTAAAGGGGAAACTTGGATGG + Intronic
1047839230 8:128731772-128731794 AGTTAAAGAAGATACTTGGTAGG + Intergenic
1052260012 9:26503855-26503877 AGGTAAAGAAGAGGTTGGGAAGG - Intergenic
1058011910 9:99988208-99988230 ATGTAAAGAAGATATAGGGATGG - Intronic
1060324180 9:122596472-122596494 AGTTAAAGAGGAAACTGAGAAGG - Intergenic
1189064328 X:37790245-37790267 GGGTAAAAATGAGACTGGGAAGG - Intronic
1196776317 X:119341142-119341164 GGGAAATGACGATAATGGGAGGG - Intergenic
1198280655 X:135138752-135138774 AGGTAAAGACCCTAGAGGGAGGG + Intergenic
1198290304 X:135233762-135233784 AGGTAAAGACCCTAGAGGGAGGG - Intergenic
1198311649 X:135430650-135430672 AGGTTAGGAAGATTCTGGGAAGG + Intergenic