ID: 1003289944

View in Genome Browser
Species Human (GRCh38)
Location 6:4771743-4771765
Sequence AGGTAAAGACGATACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003289939_1003289944 23 Left 1003289939 6:4771697-4771719 CCTAGTTGTTCTCTCTCTCTCTT 0: 2
1: 4
2: 29
3: 312
4: 2058
Right 1003289944 6:4771743-4771765 AGGTAAAGACGATACTGGGATGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003289944 Original CRISPR AGGTAAAGACGATACTGGGA TGG Intronic