ID: 1003291190

View in Genome Browser
Species Human (GRCh38)
Location 6:4779644-4779666
Sequence TCCTAGCAGCTGGAAAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003291190_1003291195 4 Left 1003291190 6:4779644-4779666 CCCTACTTTTCCAGCTGCTAGGA 0: 1
1: 0
2: 3
3: 17
4: 242
Right 1003291195 6:4779671-4779693 GGAAAAACGGATTTTTGATGCGG 0: 1
1: 0
2: 0
3: 20
4: 194
1003291190_1003291196 10 Left 1003291190 6:4779644-4779666 CCCTACTTTTCCAGCTGCTAGGA 0: 1
1: 0
2: 3
3: 17
4: 242
Right 1003291196 6:4779677-4779699 ACGGATTTTTGATGCGGCGTAGG 0: 1
1: 0
2: 0
3: 2
4: 10
1003291190_1003291194 -9 Left 1003291190 6:4779644-4779666 CCCTACTTTTCCAGCTGCTAGGA 0: 1
1: 0
2: 3
3: 17
4: 242
Right 1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG 0: 1
1: 0
2: 0
3: 30
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003291190 Original CRISPR TCCTAGCAGCTGGAAAAGTA GGG (reversed) Intronic
902196754 1:14803855-14803877 TCCTAGCACATGGAAGAGGAAGG - Intronic
903546919 1:24130308-24130330 TCACAGCAGCTGGAAAATGAGGG + Intronic
906713315 1:47948900-47948922 TCATGGGAGCTGGAAATGTAGGG - Intronic
906714084 1:47954189-47954211 TCCTGGCAGCTGGAAGTGTGGGG + Intronic
907491037 1:54808928-54808950 TCCTAGCAGAGGGAACAGCAGGG - Intronic
908262523 1:62349846-62349868 CTCTAGAAGCTGGAAAAGCAAGG - Intergenic
908713281 1:67042312-67042334 TCCTAGGAGCTGGGAAAATATGG - Exonic
909913553 1:81290483-81290505 ACCTAGCTGCTGGAAGAGTGGGG - Intergenic
909933147 1:81521059-81521081 TGCTAGCTGCAGGAAAAGCAAGG + Intronic
910430917 1:87159016-87159038 TCTCAGCAGCTGGAGGAGTAAGG - Intronic
911209247 1:95122043-95122065 TCCTAGCAGCAAGAAAAGCCTGG + Intronic
911769254 1:101718561-101718583 TCCTAGTAGCAGGAAATATAAGG + Intergenic
913082689 1:115403463-115403485 TCTTAGCAGCTGAATAAGTGGGG - Intergenic
913126160 1:115792414-115792436 TCCAAGCTGCTGGAAGAGCATGG - Intergenic
913573196 1:120142148-120142170 ACCTTCCAGCTGCAAAAGTAGGG + Intergenic
913610404 1:120504811-120504833 GCCTAGCATCTGGAAAGGTGTGG + Intergenic
913984400 1:143552022-143552044 GCCTAGCATCTGGAAAGGTATGG - Intergenic
914294453 1:146306945-146306967 ACCTTCCAGCTGCAAAAGTAGGG + Intergenic
914555497 1:148757728-148757750 ACCTTCCAGCTGCAAAAGTAGGG + Intergenic
914580786 1:149017428-149017450 GCCTAGCATCTGGAAAGGTGTGG - Intronic
915061553 1:153190102-153190124 TCCTAGCAGCAGCAGAAATAAGG + Intergenic
916844677 1:168637678-168637700 TTCTGGCAGCTGGAAAGCTACGG - Intergenic
917278345 1:173355062-173355084 TGCTAGAAGCTGGAAAAGACTGG - Intergenic
918206661 1:182315536-182315558 CCCTAGCAGCTAGACAAGGAAGG - Intergenic
920934838 1:210422412-210422434 TACTAGAAGCTGGAAAGGGAGGG - Intronic
923153696 1:231257317-231257339 TCTGAGAAGCAGGAAAAGTAGGG - Intronic
923449246 1:234101055-234101077 TCCAAGCAGAGGGAAAGGTATGG - Intronic
923615166 1:235531223-235531245 TCCCAGCTTCTGGAACAGTAAGG + Intergenic
923921463 1:238568910-238568932 TACTAGCAGCAGTAAAAATAAGG - Intergenic
1063218499 10:3944841-3944863 TCCAAGCAGCAGGATAAGAAGGG + Intergenic
1063863919 10:10343346-10343368 TCATAGCAGCAGGAAAAGGTAGG + Intergenic
1066343246 10:34556981-34557003 TCCTAACAGGTGGTAAAGGAAGG + Intronic
1066416491 10:35226434-35226456 TTCTAGAAGCTGGAAAAGACGGG + Intergenic
1067234420 10:44436115-44436137 TTCAACCAGCTGGATAAGTAGGG - Intergenic
1068697347 10:59981995-59982017 TGCTATCAGCTGGAACAGTATGG - Intergenic
1068732920 10:60379698-60379720 TACTAGAGGCTGGAAAGGTAGGG + Intronic
1070344549 10:75529209-75529231 TACTAGGAGCTGGAAAAACATGG + Intronic
1075052673 10:119194510-119194532 TCCTGGCAGCTGGAAATCTCTGG - Intergenic
1077233097 11:1467375-1467397 TCCTAGAAGCTGGGAAAGGAAGG - Intergenic
1078709033 11:13772463-13772485 TGCAAGCAGCTGGAAAATCATGG + Intergenic
1079776181 11:24531587-24531609 TACTAGAAGGTTGAAAAGTAGGG - Intronic
1081182304 11:39998505-39998527 TCATAGCAGCAGAAAAAGAAAGG + Intergenic
1082932314 11:58621302-58621324 ACCTAGTAGATGGAAAATTAAGG + Intronic
1084357128 11:68647304-68647326 GCTGAGCAGCTGGAAAATTAAGG - Intergenic
1085037123 11:73307548-73307570 GCGTGGCAGCTGGAAAAGTAGGG + Intergenic
1085158066 11:74314254-74314276 TTCTAGAAGCTGGAAAGGCAAGG + Intergenic
1087837680 11:102891110-102891132 TCCTAGGAGCATGAAAAGCAGGG - Intergenic
1088579650 11:111301955-111301977 CACATGCAGCTGGAAAAGTAAGG + Intronic
1088973807 11:114796898-114796920 TCCAGGCAGATGGAAAAGTATGG + Intergenic
1091345318 11:134848837-134848859 CCCTAGAAGCTGGAAAGGCAAGG - Intergenic
1092892444 12:12981315-12981337 TCCTGGGAGCTGGAAATATAAGG + Intronic
1092957996 12:13567725-13567747 TCCAGGCAGCAGGAATAGTATGG + Intronic
1093018913 12:14185114-14185136 TTCTAGAAACTGGAAAAATAGGG + Intergenic
1096499054 12:52054525-52054547 TCCTGGCAGCTGGTAGAGGAAGG - Exonic
1097225885 12:57476635-57476657 TCCCAGGAGGTGGAAAAGTCGGG - Exonic
1098469514 12:70827233-70827255 TCCTAGCAGCTGGAGAGACATGG - Intronic
1100924191 12:99524975-99524997 TCATAGAAGCTGGAAAAGGCAGG + Intronic
1101759476 12:107646940-107646962 TCCTAGCAGAGGGAACAGTGTGG + Intronic
1101818431 12:108163735-108163757 TTCTAGAAGCTGAAAAAGCAAGG + Intronic
1101841649 12:108331800-108331822 CTCTAGAAGCTGGAAAAGGAGGG + Intronic
1102772120 12:115487037-115487059 TCCTAGAAGCTGGGAAAGACAGG + Intergenic
1103921928 12:124403673-124403695 TCCAAGCAGATGGAAGAGGAGGG + Intronic
1104646970 12:130504541-130504563 CCCTTGCAGCTGGAAAGGCAAGG + Intronic
1106083155 13:26517195-26517217 TCCCAGCAGCTGGAAAAGACTGG - Intergenic
1107348280 13:39486688-39486710 TCCCACCAGCTTGAAAAGCAGGG + Intronic
1107627894 13:42309043-42309065 TCCTAACAGCAGGACAAGCAGGG - Intronic
1107630362 13:42336398-42336420 TTCTAGAAGCTGGAAAAGGCAGG + Intergenic
1107737332 13:43413483-43413505 ACCATGCAGCTGGAAAAGGAGGG + Intronic
1108539515 13:51426333-51426355 TCCTAGCGGCAGGAAAAATGTGG - Intronic
1108823530 13:54382824-54382846 TTCTTTCAGTTGGAAAAGTATGG + Intergenic
1113157093 13:107335717-107335739 TACAGGCAGCTGGAAAAGGAAGG + Intronic
1117539329 14:56731365-56731387 TCCAAGCAGCTTGCAAAGTGAGG - Intergenic
1120261632 14:82192302-82192324 GCCTAGGAGCTGGAAAAGGCAGG + Intergenic
1120388844 14:83880312-83880334 TCATGGCAGCTAGAAGAGTATGG - Intergenic
1120809597 14:88790734-88790756 ACCTAGCATATGGAAAAGAAGGG + Intronic
1121682490 14:95805284-95805306 TACTAGCAGATGGAATAGTGGGG + Intergenic
1122414493 14:101542397-101542419 TTCTAGAAGCTGGAAAAGCAAGG + Intergenic
1126865122 15:52927908-52927930 CTCTAGAAGCTGGAAAAGCAAGG - Intergenic
1128695858 15:69762338-69762360 TTCTAGAAGCTGGGATAGTAAGG - Intergenic
1128774429 15:70308920-70308942 TCTCAGCAGCTGGAAGAGTGAGG - Intergenic
1128929473 15:71691158-71691180 CTCTAGCAGCTGGAAAGGCAAGG + Intronic
1129115891 15:73365235-73365257 GCCTAGAAGCAGGAAAGGTATGG + Intronic
1129777729 15:78247643-78247665 TTCTAGAAGCTGAAAAAGCAAGG + Intergenic
1133035143 16:3030229-3030251 GCCTGGCAGCTGGAAGAGCAGGG - Intronic
1133693326 16:8236835-8236857 TCCAAACAGATGGAAAAGTTAGG - Intergenic
1133829332 16:9307210-9307232 TCCTAGCAGGTGCAATAGGATGG - Intergenic
1134676359 16:16093386-16093408 CTCTAGCAGCTGGGAAAGAAAGG - Intronic
1136399099 16:30008186-30008208 TCCTAGGAGATGGAGATGTAGGG - Intronic
1137930340 16:52581241-52581263 TCCTAGCATCTGGAAGAGTGGGG - Intergenic
1138835394 16:60428715-60428737 TCCTAGCACCTAGAACATTATGG - Intergenic
1140692068 16:77494074-77494096 TCCTAGCAGCTACATAAGAATGG - Intergenic
1141854686 16:86673046-86673068 CCCTAGAAGCTGGAAAAGTCAGG + Intergenic
1143809234 17:9457318-9457340 CCCTAGAAGCTGGAAAGGCAAGG - Intronic
1144239039 17:13291345-13291367 TGCTGACAACTGGAAAAGTATGG - Intergenic
1144778091 17:17794956-17794978 TCCTTGCAGCTGGACAAGGGCGG + Exonic
1146621597 17:34402660-34402682 GCTTAGCAGCTGTAAAAGGATGG + Intergenic
1149262515 17:54895416-54895438 TCCTAAGAGCTGGAAAAGAAAGG + Intergenic
1149381454 17:56098151-56098173 TGCCAGAAGCTGGAAAAGAATGG + Intergenic
1151903342 17:77032285-77032307 CTCTAGAAGCTGGAAAAGCAAGG + Intergenic
1152677800 17:81650707-81650729 TCCTCCCAGCTGGAAAGCTAGGG - Exonic
1153143344 18:2000429-2000451 CTCCAGCAGCTGGAAAAGTCAGG + Intergenic
1157070445 18:44401300-44401322 TCCTAAAAGCTGGCACAGTAGGG - Intergenic
1157272565 18:46287811-46287833 TCCCAGCAGATGGAAAAACAAGG + Intergenic
1157308874 18:46537062-46537084 TCCTAGCAGAGGGAACAGCATGG - Intronic
1157333347 18:46719529-46719551 TACTGGCAGCAGGAAAAGTTAGG + Intronic
1157668509 18:49508788-49508810 TACTAGAAGCTGGAAGGGTAGGG + Intergenic
1160053721 18:75460242-75460264 CTCTAGAAGCTGGAAAAGGAAGG + Intergenic
1161503159 19:4628770-4628792 CTCTAGAAGCTGGAAAAGCAAGG - Intergenic
1161645692 19:5451925-5451947 TCCTGGCAGCTAGAACAGCACGG - Intergenic
1162788957 19:13053387-13053409 TCTTGGCATCTGGAAAAGTTTGG - Intronic
1165194273 19:34089293-34089315 TCATGGCAGCTTGAAAAGGATGG + Intergenic
1165788766 19:38478232-38478254 TCCTAGCAGCTGGCGCAGTGGGG - Intronic
1166932788 19:46311512-46311534 CTCTAGCAGCTGGAAAAGGCAGG - Intronic
925691749 2:6531556-6531578 CACTAGCAGCTAGAAAAGAAAGG - Intergenic
925712913 2:6758797-6758819 TTCTAGCAGCTAGAAAAGGTGGG + Intergenic
926148466 2:10411402-10411424 TTCTAGGAGCTGGGAAAGTGGGG - Intronic
926985531 2:18618547-18618569 TCCTTGCAGCTGCAGAACTATGG + Intergenic
927373719 2:22388514-22388536 TCATAGCTTCAGGAAAAGTATGG - Intergenic
928033123 2:27798204-27798226 TCATAGCAGCTGAAACTGTATGG - Intronic
928798762 2:35060090-35060112 TCCCAGCAACTTGAAAAGAATGG + Intergenic
930978653 2:57495053-57495075 TTCTAGAAGCTGGAAAAGACAGG + Intergenic
931500274 2:62857055-62857077 TTCTAGAAGCTGGAAAAGGGAGG + Intronic
932317770 2:70797491-70797513 CCCAAGCAGCTGGAAATGTGAGG - Intergenic
933789346 2:85871728-85871750 ACCCTGCTGCTGGAAAAGTATGG - Intronic
934545776 2:95214579-95214601 TCCTTGCTGCTGAACAAGTAAGG - Exonic
935679602 2:105624603-105624625 CTCTAGAAGCTGGAAAAGGAGGG - Intergenic
936090210 2:109496992-109497014 TTCTAGCAACTGGAAAGGCAAGG + Intronic
937012409 2:118574197-118574219 TCCAGGCATGTGGAAAAGTATGG + Intergenic
939182464 2:138819529-138819551 TCCTAACAGCTGGAAGACTCTGG + Intergenic
939206715 2:139115458-139115480 AGGTAGCAGCTGGAAAAGTTAGG - Intergenic
939732983 2:145808365-145808387 TCCTAGCAGCAGAAACAGCAGGG - Intergenic
941000769 2:160201553-160201575 TCCAAGAAGCTGGAAAAACATGG + Intronic
941050812 2:160731611-160731633 TTCTAGAATCTGGAAAAGCAAGG - Intergenic
943909282 2:193542453-193542475 GCCTCCCAGCTGCAAAAGTAAGG - Intergenic
945567255 2:211415917-211415939 TCTTAGCAGATAGAAAAGAAGGG + Intronic
946336607 2:219041640-219041662 TACTACCAGCAGGAAAAGTCAGG - Intergenic
947208842 2:227687129-227687151 TAGTAGCAGCTGGAAAATTCTGG - Exonic
948857640 2:240737459-240737481 TCCTGACTGCTGGAAAAGGAAGG + Intronic
1169775555 20:9248972-9248994 TGCTAGAAGCTGGAAATGGAAGG - Intronic
1172181350 20:33005606-33005628 TTCTAGAAGCTGGAAAAGGCAGG + Intergenic
1172298861 20:33833703-33833725 TCCAAGCAGCAGGAAAAGAGAGG - Intronic
1174305566 20:49612155-49612177 TCCTGGCAGAGGGAAAAGTCAGG + Intergenic
1176384707 21:6133610-6133632 TCCTGGCAGCTGGAAAAGAAGGG - Intergenic
1177999238 21:28140471-28140493 TTCTAGCAGCTGGAAAAGGCAGG + Intergenic
1178071979 21:28978150-28978172 TCCAAGCAGCTGGGACAATAGGG + Intronic
1179047754 21:37861554-37861576 CCCTAACATCTGGAGAAGTAGGG + Intronic
1179402821 21:41099916-41099938 TTCTAGAAGCTGGAAAAGGCAGG - Intergenic
1179738765 21:43404642-43404664 TCCTGGCAGCTGGAAAAGAAGGG + Intergenic
1181486341 22:23234158-23234180 TCCTATCAGCTAGTAAAGGAGGG + Intronic
1182628133 22:31663375-31663397 GCTTAGCAGATGAAAAAGTAGGG - Intergenic
1183940001 22:41288668-41288690 TCCTATCAGCTGGATGAGGACGG - Intergenic
949739468 3:7213831-7213853 TCCCAGCAGCTGGGAGAGTTAGG + Intronic
950076337 3:10189837-10189859 CCCTAGCAGCTGGAAAGGGGCGG - Intronic
953184534 3:40625826-40625848 TCCTAGTTTCTTGAAAAGTAGGG - Intergenic
954128649 3:48548266-48548288 TCCCAGCATCTGGAAAAGTGAGG + Intronic
956559595 3:70560033-70560055 GCCTAGCAGCAGGAAAAATCAGG + Intergenic
957281105 3:78152726-78152748 ACCTAGCCCTTGGAAAAGTAAGG + Intergenic
958515758 3:95113230-95113252 TCCTAGAAGCTAGATAAATATGG + Intergenic
960078382 3:113514573-113514595 TCCAAGCAGAGGGAAAAGAATGG - Intronic
960094293 3:113673745-113673767 TCCTGGCACCTGGACCAGTACGG + Intronic
963328641 3:143890015-143890037 TCCTATGAGCTGGAAGAGTGAGG + Intergenic
963519787 3:146349362-146349384 TTCTAGCCACTGGAAAAGCAAGG + Intergenic
965246685 3:166280622-166280644 CTCTAGCAGCTGGAAAAGCATGG - Intergenic
965630943 3:170731992-170732014 TCCTAGGAGCTAAAAAGGTAGGG - Intronic
969316755 4:6386343-6386365 TCGCAGCAGCTGGAAAAATGTGG + Intronic
970038987 4:11774364-11774386 TACCTGCAGATGGAAAAGTAAGG - Intergenic
971506023 4:27367457-27367479 TTCTAGGAGCTGGAAAGGCAAGG - Intergenic
971786361 4:31108588-31108610 ATCTCACAGCTGGAAAAGTAAGG + Intronic
972156364 4:36168260-36168282 CCCCAGAAGATGGAAAAGTAAGG - Intronic
974394791 4:61320924-61320946 CTCTAGCAGCTGAAAAAGCAAGG - Intronic
974768145 4:66375285-66375307 TCATAGAAGCTTGAAAAGAAGGG - Intergenic
976650649 4:87430215-87430237 CTCTAGAAGCTGGGAAAGTATGG + Intronic
976940188 4:90690696-90690718 TCCTTGCTGCTGGAAGAGGATGG - Intronic
977116607 4:93036241-93036263 TCCTACCATCTGTAAAGGTAAGG - Intronic
978350281 4:107813895-107813917 TCCTAGCACTTTGGAAAGTATGG + Intergenic
978372949 4:108047308-108047330 TCATACCACCTGGAAAAGGAGGG + Intergenic
978744823 4:112180768-112180790 CTCTAGCAACTGGAAAAGTACGG + Intronic
978859644 4:113432806-113432828 TTCTAGAAGCTGGAAAAGGCAGG + Intergenic
979845840 4:125510587-125510609 TTCTAGAAGCTGGAAAAGGCAGG - Intergenic
982908240 4:161105563-161105585 TTCTGGCAGGTGGAAAAGAAAGG - Intergenic
983070739 4:163264981-163265003 TCATATCAACTGGCAAAGTATGG + Intergenic
984345898 4:178524587-178524609 CTCTAGAAGCTGGAAAAGGAAGG + Intergenic
985090270 4:186355443-186355465 AACTAGAAGCTGGAAGAGTAAGG - Intergenic
988879601 5:35486739-35486761 TCCTAGCAGCTGCATGAGTTTGG - Intergenic
990288489 5:54325412-54325434 TCCTAGCAGAAGGGAAATTAAGG + Intergenic
992624541 5:78625322-78625344 TCCTAGCTGCTGGTAAGGAAAGG + Intronic
994797683 5:104325936-104325958 TTTTAGAAGCTGGAAAAGGATGG - Intergenic
995026936 5:107434520-107434542 TTTTAGTAGCTGGAAAAGGAAGG + Intronic
996066112 5:119081091-119081113 TCCAAACAGCTGGCAAGGTAGGG + Intronic
997640617 5:135446517-135446539 TCCTAACAGCTGGAACCGTCAGG - Exonic
999480948 5:151947842-151947864 TCCTGGCAGCAGGAAAAGAATGG - Intergenic
1000541369 5:162544553-162544575 CCCTAGCAGGAGGAAATGTATGG - Intergenic
1001826498 5:174749733-174749755 TCCCAGCAGCTTGAGAAGCAAGG - Intergenic
1001907530 5:175485385-175485407 CCCTAGCAGCTGGAAAGGGCAGG - Intronic
1002303815 5:178272149-178272171 TCTTACCAGCTGGAAACGCAGGG - Intronic
1003291190 6:4779644-4779666 TCCTAGCAGCTGGAAAAGTAGGG - Intronic
1005557956 6:27007432-27007454 CTGTAGCAGCTGGAAAAGTTGGG - Intergenic
1007078787 6:39084526-39084548 TCCTGGCAGCTGCACAAGTGGGG + Intronic
1007908613 6:45489978-45490000 CCATAGCAGCTGGAAGAGGAAGG + Intronic
1009676802 6:66835302-66835324 TCCTAGCTGCTTGAAAAAAAAGG + Intergenic
1009983020 6:70748071-70748093 TTCCAGCTGCTGGAAAAGAAGGG - Intronic
1010333333 6:74650222-74650244 TCCTAGAAGAAGGAAGAGTATGG - Intergenic
1010690579 6:78907026-78907048 TCCTAGCAGCTGTATCAATATGG - Intronic
1010709957 6:79162213-79162235 TCACAGCAGCTGGGAAAGGAAGG + Intergenic
1011597010 6:89025759-89025781 GCCTAGAAGCTGGAAGAGCACGG - Intergenic
1013115022 6:107096690-107096712 TGTCAGTAGCTGGAAAAGTAGGG + Intronic
1014253414 6:119138456-119138478 TTCTAGAAGCTGGTAAGGTAAGG - Intronic
1015929114 6:138339212-138339234 TCCCAGCAGGTGGAGAAGAAAGG + Exonic
1016795155 6:148110040-148110062 TCCAGTCAGCTGGGAAAGTAGGG - Intergenic
1017484830 6:154892801-154892823 TCCTAGAAGCTGGAAACAAAAGG - Intronic
1017521269 6:155205442-155205464 TCCTGGCTGCTGGAAAGGCAGGG + Intronic
1018907372 6:168083352-168083374 TCTTAGCAGCAGGAAGGGTAAGG + Intergenic
1021692381 7:23243104-23243126 CCCTAGAAGCTGGAAAGGCAAGG + Intronic
1022039006 7:26562129-26562151 TCAAAGCAAATGGAAAAGTAAGG - Intergenic
1022323385 7:29308079-29308101 TCAAAGGAGTTGGAAAAGTATGG + Intronic
1024730670 7:52250651-52250673 TCCAAAAAGCTGTAAAAGTATGG + Intergenic
1026022362 7:66719127-66719149 GCCTAGAAGCTGGGACAGTAGGG + Intronic
1027605997 7:80299445-80299467 CCCTACAAGCTGGAAAACTAGGG - Intergenic
1027756165 7:82214490-82214512 TCCCAGCAGCTGGGAAAGTAAGG + Intronic
1028345602 7:89778370-89778392 TCCTCTCAGATGAAAAAGTAAGG + Intergenic
1028353814 7:89881985-89882007 TCTGAGTAGCTGGAAAACTAGGG - Intergenic
1028538379 7:91914901-91914923 TCCTCTCTGCTGGAAAAATAAGG - Intergenic
1028720747 7:94028000-94028022 TCCTGGAAGCTGGAAAAGACAGG + Intergenic
1031728586 7:125268514-125268536 TTCTAAAAGCTGGAAAAGTCAGG - Intergenic
1031750472 7:125565303-125565325 TCCTCTCATCTGGAAATGTAAGG + Intergenic
1032503989 7:132422145-132422167 CCCTAGGAGCTGGAAAACAAGGG + Intronic
1033505735 7:141997824-141997846 ACCAAGCAGCTGGGAAAGGATGG + Intronic
1033619303 7:143048181-143048203 TTCTAGAAGGTGGAAAAGCAAGG + Intergenic
1037128932 8:15384531-15384553 TCCTAGGAGATGGAACAGTCAGG - Intergenic
1038850293 8:31268986-31269008 TCCCAGCAGCTGGGAAAATGAGG - Intergenic
1042122923 8:65507654-65507676 ACCTACCAGCTGCAAAAGAAAGG + Intergenic
1042456294 8:69007857-69007879 TCTTTGCAGCTGGAAAACTGAGG + Intergenic
1042525560 8:69761323-69761345 CTCTAGAAGCTGGAAAAGCAAGG - Intronic
1043566263 8:81551943-81551965 TCCTAGAAGCTAGCACAGTATGG - Intergenic
1043767425 8:84154236-84154258 GACTAGCAGATGGAAAAGCAAGG + Intergenic
1043859345 8:85297926-85297948 CCCTAGCAGCAGCAAAAGCAAGG - Intergenic
1044590029 8:93905324-93905346 TCCTTTCATCTTGAAAAGTAGGG - Intronic
1044743124 8:95347800-95347822 TCCAAGCATCTGGAACAGCATGG + Intergenic
1045100801 8:98842361-98842383 TCCTAGCAGGTGGCAAAACATGG + Intronic
1045797427 8:106062297-106062319 GCCTAGGAGCGGGAAAAGGAAGG + Intergenic
1047990658 8:130283179-130283201 CCACACCAGCTGGAAAAGTAAGG + Intronic
1050429742 9:5550576-5550598 CTCTAGCAGCTGGAAAAGACAGG - Intronic
1050593126 9:7180342-7180364 TTCTAGAAGCTGGAAAGGCAAGG + Intergenic
1050985232 9:12073701-12073723 TCATACCTGCTGTAAAAGTAAGG + Intergenic
1052946070 9:34169129-34169151 TCCCAGCAGCTGGGAGAGTAAGG + Intergenic
1053531742 9:38888925-38888947 TTCTAGAATCTGGAAAAGTCAGG + Intergenic
1054203965 9:62113353-62113375 TTCTAGAATCTGGAAAAGTCAGG + Intergenic
1054634397 9:67475012-67475034 TTCTAGAATCTGGAAAAGTCAGG - Intergenic
1056162034 9:83906360-83906382 TCCTAGCAGTTAGGAAAGTTAGG - Intronic
1061384407 9:130280034-130280056 CTCTAGCAGCTGGAAAAGGCAGG + Intergenic
1061595215 9:131624520-131624542 TTCTAGGAGCTGGAAGGGTAAGG + Intronic
1062058164 9:134479794-134479816 TCTGAGCAGCCGGGAAAGTATGG - Intergenic
1062307234 9:135914886-135914908 CCCTAGAAGCTGGAAAAGGCAGG + Intergenic
1185934700 X:4242732-4242754 TCATAGTATCTGGAAAGGTATGG - Intergenic
1186118819 X:6335457-6335479 TCCTACCAGCTAGAATAGCATGG + Intergenic
1189691819 X:43624724-43624746 TCCTCGCAGCTGCAAAAAAAAGG - Intergenic
1192093695 X:68187467-68187489 TTCTAGAAGCTGAAAAGGTAAGG + Intronic
1194180457 X:90705128-90705150 TTCTGGTAGCTGGAAAAGTGTGG + Intergenic
1196566302 X:117208927-117208949 TATTAGCAGCTGGAAAGGTTAGG + Intergenic
1197048126 X:122025367-122025389 TCATAGCAGCTCCCAAAGTAAGG + Intergenic
1197884721 X:131206404-131206426 TCCGAGCAACTGGAACACTAAGG - Intergenic
1200291335 X:154877457-154877479 CTCTAGAAGCTGGAAAAGAAAGG + Intronic
1201472352 Y:14347664-14347686 TCATAGAAGCTGGAAAACTTGGG + Intergenic