ID: 1003291194

View in Genome Browser
Species Human (GRCh38)
Location 6:4779658-4779680
Sequence CTGCTAGGATTGAGGAAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003291191_1003291194 -10 Left 1003291191 6:4779645-4779667 CCTACTTTTCCAGCTGCTAGGAT 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG 0: 1
1: 0
2: 0
3: 30
4: 253
1003291190_1003291194 -9 Left 1003291190 6:4779644-4779666 CCCTACTTTTCCAGCTGCTAGGA 0: 1
1: 0
2: 3
3: 17
4: 242
Right 1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG 0: 1
1: 0
2: 0
3: 30
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003291194 Original CRISPR CTGCTAGGATTGAGGAAAAA CGG Intronic
901725040 1:11235084-11235106 CTGCTATGACTGGGGAAAACAGG - Intronic
903299370 1:22367381-22367403 CTGCTGGGGTTGTGGAGAAAAGG + Intergenic
904010387 1:27386366-27386388 CAGCTAGGATAGAGGAAGAGAGG - Intergenic
907951020 1:59184306-59184328 CTGCAAGGAAAGATGAAAAATGG - Intergenic
908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG + Intergenic
909744011 1:79070229-79070251 ATGTTACCATTGAGGAAAAATGG + Intergenic
911401133 1:97376938-97376960 CAGCTAGGATGGAGTAAAAGTGG - Intronic
911703254 1:100980470-100980492 ATGCTAAGTTTGAGGATAAAAGG - Exonic
911737816 1:101356826-101356848 CTGCTGAGAATGTGGAAAAAAGG - Intergenic
913361609 1:117987084-117987106 ATGCTAGGTTTGATGAAGAATGG - Intronic
915646826 1:157278543-157278565 CTGTTAGGAAGGAGGAAAATCGG + Intergenic
915665116 1:157437469-157437491 CAGCCAGGGTTGGGGAAAAAAGG - Intergenic
915836268 1:159178371-159178393 TTGCTAAGGTTGAGGGAAAAGGG - Intronic
915924905 1:160009661-160009683 TTTCTAGGGTAGAGGAAAAATGG - Intergenic
916471987 1:165132924-165132946 ATGCTGGGATGGAAGAAAAAAGG + Intergenic
916990068 1:170233514-170233536 CTCCTAGGTATGAGGAACAATGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
920003191 1:202813101-202813123 CTGCCAGGAAAGAGGAAAAAGGG - Intergenic
920976749 1:210792967-210792989 CTACTTGGATAGGGGAAAAATGG + Intronic
921568952 1:216755615-216755637 CAGCAAGGATTGAGTTAAAAAGG - Intronic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063257873 10:4349197-4349219 CTGCTGGGATTAGAGAAAAATGG - Intergenic
1063782004 10:9335796-9335818 CTGCTAGGCTTGAAGAAATTTGG - Intergenic
1063794509 10:9496943-9496965 CTGTTGGGATTGGGTAAAAATGG + Intergenic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1067508518 10:46876453-46876475 CTGCCAGAATTGAGCCAAAAGGG + Intergenic
1067653730 10:48175396-48175418 CTGCCAGAATTGAGCCAAAAGGG - Intronic
1067785613 10:49243438-49243460 CTGCAAGGAGTGTGGAAGAAAGG + Intergenic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG + Intronic
1070141316 10:73740469-73740491 CTACTAGGAATGATGAAAATGGG - Intergenic
1074679013 10:115884044-115884066 ATGCTAGAGCTGAGGAAAAATGG + Intronic
1074782132 10:116809655-116809677 CTCCTGGGATTCAGGAAAATTGG + Intergenic
1075901163 10:126043680-126043702 CTGCTAGGATTGCAGGAAACAGG - Intronic
1076414245 10:130273892-130273914 CTCCAAGGATTTAGGGAAAAAGG - Intergenic
1079067474 11:17308571-17308593 CTTCTAGAATTGAGCAAAATGGG - Intronic
1079435440 11:20443100-20443122 TTGGTAAGACTGAGGAAAAATGG - Intronic
1079596033 11:22247776-22247798 ATGCTAAGATTGAGAAAAATGGG + Intronic
1079967856 11:27000958-27000980 ATTCTAGGATTGATGATAAATGG + Intergenic
1080123705 11:28706186-28706208 CTGCTATGGTTGAGGGAAGAAGG + Intergenic
1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG + Intergenic
1083461010 11:62811885-62811907 CTGCTGGGTCTGAGGATAAAAGG - Intronic
1084613509 11:70219180-70219202 CTGCTAAGAGTGAAGAAGAAGGG + Intergenic
1085265649 11:75236462-75236484 CTGCTGGGACAGAGGACAAAGGG + Intergenic
1088456448 11:110037342-110037364 CTGATAGGATTTAGGAGAAGAGG - Intergenic
1091077793 11:132637259-132637281 CTGCCAGGATTGGAAAAAAACGG - Intronic
1093441348 12:19200546-19200568 CTACTAGGAATGAGGAAAAGAGG - Intronic
1095425895 12:42074494-42074516 CTGCTTGGTTTGAAGAGAAAGGG + Intergenic
1096994662 12:55831057-55831079 CTGCCAGGATTGAGGAGAGGAGG - Intergenic
1100021903 12:90079074-90079096 GGACTAGGATTGAGGAAAATGGG + Intergenic
1102784031 12:115589310-115589332 CTGCCAGGACTGAGGCAATAGGG + Intergenic
1103221903 12:119253200-119253222 CTGCTATGTTTGGGGAAACAAGG - Intergenic
1104928676 12:132327156-132327178 CAGCTAGGATGAAGGAAAGAAGG + Intronic
1105402090 13:20105010-20105032 GTGCTAGGATGGAAGAACAAAGG + Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1105664960 13:22543809-22543831 CTCCTACGATTCAGAAAAAAAGG - Intergenic
1106606269 13:31232001-31232023 CTGTCAGGATTGAGGCAAGATGG + Intronic
1108588634 13:51892806-51892828 CTGCTAGGACGGAGGAACAAAGG - Intergenic
1108738668 13:53312098-53312120 CTCAAAGGATTGAGGAAGAATGG - Intergenic
1109047070 13:57426088-57426110 CTTCTAGGGATGGGGAAAAATGG + Intergenic
1110146313 13:72194894-72194916 CTGCAAGGTTTGAGGAAGACGGG + Intergenic
1110418614 13:75279358-75279380 CTGCAGGGATTGGGGAAAAGGGG + Intergenic
1113239334 13:108318872-108318894 CTGGTGAGATTGAGGAGAAAAGG - Intergenic
1113247634 13:108416179-108416201 CTGGCAAGATTGAGGAGAAATGG - Intergenic
1114722421 14:24896770-24896792 GGGCTAGGAATGAGGAGAAAAGG + Intronic
1115384229 14:32777021-32777043 CTACTATGAGTGAGGGAAAAGGG - Intronic
1116307794 14:43281073-43281095 CTGGGAGGATTGAGAAAGAAGGG - Intergenic
1117403221 14:55376811-55376833 CTGCTAAGAGCAAGGAAAAAAGG + Intronic
1117533734 14:56684693-56684715 CTCTTAGGATGGAGGAAAAATGG - Intronic
1118971815 14:70643257-70643279 CTGCTAGGGGTGAAGGAAAAGGG + Intronic
1123788821 15:23699463-23699485 CTGCTATGATTCCGAAAAAATGG - Intergenic
1123962172 15:25415137-25415159 TTGGTAAGTTTGAGGAAAAAAGG - Intronic
1125361956 15:38873769-38873791 CTGCAAAGATTAAGGAAGAACGG - Intergenic
1125895628 15:43299490-43299512 CAGCTAGGGTGGATGAAAAATGG + Intronic
1126323986 15:47455274-47455296 ATGCTGGGATTGTGGAAAGAGGG - Intronic
1127319244 15:57826606-57826628 CTGGTAGCAATGAGGAAAATAGG - Intergenic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1129354175 15:74978119-74978141 TTGATAGCACTGAGGAAAAAGGG + Intronic
1129360868 15:75023359-75023381 CTGATAGGAGTGAGGAAAGGAGG + Intergenic
1129590220 15:76908196-76908218 CTGAGAGAATTGAGGGAAAATGG - Intergenic
1129691966 15:77718909-77718931 CTGCTAGAAATGAGGAAATAAGG - Intronic
1130888965 15:88117022-88117044 CAGCTAAGGTTGAGGAACAATGG - Intronic
1135110177 16:19684577-19684599 CTGTAAGGATTAAGGGAAAAAGG - Intronic
1135878463 16:26228106-26228128 ATGCTTGGATTGAGGAACAAGGG + Intergenic
1137424555 16:48366366-48366388 GAGCTAGAATTGAGGAAATATGG - Intronic
1139223767 16:65213930-65213952 CTCCTACGGTTTAGGAAAAAAGG - Intergenic
1140022270 16:71249659-71249681 CTGTTTGGAATGAGCAAAAACGG - Intergenic
1140651579 16:77094185-77094207 GTGCTAGGACTGAGGAAGACAGG - Intergenic
1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG + Intergenic
1142663522 17:1447925-1447947 GAGCAAGAATTGAGGAAAAAAGG - Intronic
1143914419 17:10278463-10278485 GTTCTAGGATTGAGGAATACAGG + Intergenic
1144221465 17:13103655-13103677 ATGCTAGGTTTGATGAAGAATGG + Intergenic
1145052652 17:19675539-19675561 CTGCCTGGAGAGAGGAAAAAAGG - Exonic
1146571271 17:33955411-33955433 TTGCAAGGATGGAGAAAAAAAGG + Intronic
1147907824 17:43834046-43834068 CTGCTGGGATTGAGGGAAGGGGG - Intergenic
1147930876 17:43980082-43980104 GTGTTAGAAATGAGGAAAAATGG - Intronic
1149302929 17:55321266-55321288 CTGCTTGGATTCACTAAAAAGGG + Exonic
1153515471 18:5896601-5896623 CAGCCAGGATTCAGGAAGAAAGG + Intergenic
1154373460 18:13787846-13787868 GTGCTAGGAGAGGGGAAAAAAGG - Intergenic
1155421179 18:25658286-25658308 CTATGAGGATTGAGGAAAAAGGG - Intergenic
1155758470 18:29532973-29532995 CTGGCATGATTGTGGAAAAAAGG + Intergenic
1156451698 18:37270122-37270144 CGGCTAAGTTTGAGGAAAAAAGG + Intronic
1157648053 18:49298002-49298024 ATGCTAGGAAAGGGGAAAAAAGG + Intronic
1163479080 19:17544033-17544055 GTGCTAGGATTAAGGTCAAATGG - Intronic
1164715833 19:30389701-30389723 CTGCTAGGATTCAGGAGCCAAGG - Intronic
1166237540 19:41467399-41467421 CTGCTAGTATCCAGGAAGAAAGG - Intergenic
1166895592 19:46020061-46020083 CTGCAAGGATTCAGTAAAACAGG - Intronic
1168280357 19:55302377-55302399 CTCCCAGGTTTGAGGGAAAAAGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
927984835 2:27402107-27402129 CTGCTAGCATTGGGTCAAAAAGG + Intronic
929033351 2:37669560-37669582 CTGCTCAGATTGAGGGAAAGAGG + Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930595521 2:53383033-53383055 CTGGGAGGAGAGAGGAAAAAGGG + Intergenic
931073833 2:58686507-58686529 ATGCTTGGATTTAGGAAAATAGG + Intergenic
931444978 2:62319392-62319414 CAGCCTGGATTGAGAAAAAAAGG + Intergenic
931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG + Intergenic
933423052 2:82076390-82076412 CTTCTAGGATGCAGGAAAACTGG + Intergenic
933480359 2:82849152-82849174 CTGCAAGTATTGAAGAAAAGGGG - Intergenic
933506953 2:83189056-83189078 CATCTAGGGTTGAGGAATAATGG + Intergenic
933529848 2:83494366-83494388 CAGCAAGGTTTGAGGATAAAAGG + Intergenic
934146610 2:89100957-89100979 CTGCATGCATTGAGGAAACACGG - Intergenic
934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG + Intergenic
934222655 2:90099617-90099639 CTGCATGCATTGAGGAAACACGG + Intergenic
934233574 2:90209410-90209432 CTGCATGCATTGAGGAAACACGG + Intergenic
934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG + Intronic
936286685 2:111186694-111186716 ATGCTAGGTTGGAGGGAAAAGGG - Intergenic
940117776 2:150228118-150228140 ATGTTAGGATTGAGGAAATATGG - Intergenic
940450631 2:153831657-153831679 CTGCTAAGGCTGAGGAAACAGGG - Intergenic
940812161 2:158257148-158257170 CAGCTAGGACTGAGGAAAGCAGG - Intronic
941879874 2:170470252-170470274 TTGGTGGGATTGAGGAGAAAAGG - Intronic
942095835 2:172535784-172535806 CTACAAGGATGGAAGAAAAAAGG + Intergenic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
944121893 2:196249447-196249469 GTGCTTGGAATGAGGAAAAGGGG + Intronic
944400370 2:199319407-199319429 CTGCTGGGATAAAAGAAAAAGGG - Intronic
945554034 2:211256935-211256957 ATGCTAGGCTGGATGAAAAATGG - Intergenic
945579291 2:211572636-211572658 CTGCTAGGCTTGAAGAAACCAGG - Intronic
949048932 2:241886736-241886758 CTGCAGAGAATGAGGAAAAATGG + Intergenic
1168904976 20:1395837-1395859 CTGCTAGGCTTCAGGGAAAACGG - Intergenic
1169431438 20:5539773-5539795 CTGCTAGGATGGAGGCGTAAAGG + Intergenic
1170069714 20:12352939-12352961 CTCCAAGGATTGAGGGAAGAAGG + Intergenic
1170612645 20:17927315-17927337 GTGGAAGGTTTGAGGAAAAAAGG + Intergenic
1171129482 20:22637175-22637197 CTGAAAGAATTGAAGAAAAATGG - Intergenic
1171522025 20:25783455-25783477 CTGCAAGGCCTGAGGAAGAATGG - Intronic
1171554800 20:26072428-26072450 CTGCAAGGCCTGAGGAAGAATGG + Intergenic
1173036329 20:39414580-39414602 CTGCTAGGGTAGAGCAAGAATGG - Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1174392913 20:50228904-50228926 CTGGTTGGATAGAGGGAAAAAGG - Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1175637969 20:60601385-60601407 CTACTAGGATTCTGTAAAAAAGG + Intergenic
1177071514 21:16514504-16514526 CTGCTAAGACTGCGGGAAAAGGG - Intergenic
1181139332 22:20792596-20792618 CAGCTAGGAGTGACGAAGAAAGG + Intronic
1183963499 22:41427201-41427223 GTGCTAGGCATGAGGAAATAAGG - Intergenic
949792647 3:7809995-7810017 ATGCTAGGCTTGATGAAGAATGG + Intergenic
950359409 3:12439940-12439962 CTTCCAGTATTGTGGAAAAATGG - Intergenic
950932608 3:16805519-16805541 ATGCCAGGATTGAGGAAATCTGG + Intronic
951137087 3:19117333-19117355 CTGCTAGGTTTGAGAAAAACAGG - Intergenic
951445796 3:22779030-22779052 TTGGTAAGTTTGAGGAAAAAAGG - Intergenic
952744281 3:36763274-36763296 CTGTTAGGATTGAATAACAACGG + Intergenic
953077360 3:39582643-39582665 CTGCTAAGAGTGAGGGAGAAGGG + Intergenic
956705686 3:71996897-71996919 ATGCTAGGTTTGATGAAGAATGG - Intergenic
957803968 3:85122723-85122745 CGGCAAGGATTGAGGAAAAGAGG - Intronic
960285241 3:115820922-115820944 CTGCCAGGATTTGGGAAATAAGG - Intronic
962073940 3:132060691-132060713 CTGCTGAGGTTGTGGAAAAAAGG - Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
963931983 3:151012891-151012913 CTCCTAGGATATAGGAAACAGGG - Intergenic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
966050250 3:175607847-175607869 CAGCTAGGAATGAGAAACAATGG + Intronic
967461633 3:189754276-189754298 ATGCAAGGATGGAGGAAAGAAGG - Intronic
967496025 3:190145541-190145563 CTGCTAAGAGTGAAGAAGAAGGG - Intergenic
967670828 3:192233187-192233209 CTGGTGGGGTTGTGGAAAAAAGG - Intronic
969061124 4:4436041-4436063 TTACTGAGATTGAGGAAAAAAGG - Intronic
969405664 4:6989803-6989825 CAGCTAAGGTTGAAGAAAAAAGG - Intronic
969533281 4:7741034-7741056 CTGGTAGGAGTGAGGAACCATGG - Exonic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
970451616 4:16172506-16172528 CTCCTAGAATTTTGGAAAAATGG - Intronic
970841243 4:20472917-20472939 ATCCTAGGATTAAAGAAAAAAGG + Intronic
970981393 4:22102822-22102844 CTGGTAGCATTGTGGAAAAGGGG - Intergenic
971710929 4:30111631-30111653 CTGCCAAGAGTGTGGAAAAATGG + Intergenic
971868847 4:32209253-32209275 CTGCTGAGATTGTGGAGAAAAGG - Intergenic
972935818 4:44134046-44134068 GTGAGAGGATTGAGCAAAAAGGG - Intergenic
974636121 4:64565754-64565776 CTGCTATGATTCTGAAAAAATGG + Intergenic
975379977 4:73688729-73688751 CTGGTAAGACTGAGGAGAAAAGG + Intergenic
975875745 4:78834986-78835008 ATGCTAGAATTCAGGAAAATGGG - Intronic
977180066 4:93863199-93863221 CTGGTAAGAATGTGGAAAAAAGG + Intergenic
978151188 4:105437289-105437311 CTTCTAGGAGTGAGAAAAAAGGG + Intronic
978637386 4:110825619-110825641 CTGGTAAGATTGTGGAGAAAAGG - Intergenic
979314161 4:119240406-119240428 CAACAAGGATTGAGGCAAAATGG - Intronic
980981560 4:139658618-139658640 GTGCCAGGATAGAGGAGAAAGGG - Intergenic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982626151 4:157768782-157768804 TTCTTAGGATTGAAGAAAAACGG + Intergenic
982851777 4:160326500-160326522 CTGGTAAGATTGTGGAGAAAAGG - Intergenic
982943766 4:161592077-161592099 CTACCAGGTTTGAAGAAAAAAGG + Intronic
986888480 5:12270268-12270290 CTGAAAGTATTGAGGAAAAAGGG + Intergenic
988598313 5:32615853-32615875 CTGGTGGGATTGAGGTGAAAGGG + Intergenic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
989403261 5:41032211-41032233 CTGCTAAGGTTGTGGAGAAAAGG - Intronic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
991949919 5:71937797-71937819 GTTCTAGGGTGGAGGAAAAACGG - Intergenic
991974284 5:72171131-72171153 CTGCTCAGAATAAGGAAAAAGGG + Intronic
992544494 5:77798522-77798544 CTCCTAGAATTGGGGAACAAAGG + Intronic
993748181 5:91628696-91628718 GTCCTAGGATTCAGGAAAAGAGG + Intergenic
995886114 5:116895815-116895837 ATGCTAGGTTTGATGAAAAATGG + Intergenic
996864623 5:128106050-128106072 CTGGTAGGACAGAGAAAAAAAGG - Intronic
997068071 5:130585943-130585965 CTGTTAAGATTAAGGGAAAAGGG - Intergenic
997923969 5:138010677-138010699 CTGCTAGCATAGAGGAATATAGG - Intronic
998097869 5:139407200-139407222 CTGCTAGGGCTGAGGACCAAAGG + Intergenic
998568838 5:143239244-143239266 CTGCTAGGGTTGGGAAAAACAGG + Intergenic
1000156252 5:158554802-158554824 TTCCTAGGGTTGAGGGAAAATGG - Intergenic
1000873996 5:166612988-166613010 CTGCTGGCATTGAGGAAGCAAGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003300358 6:4875160-4875182 CTGCTAGGATGCAGGACAACAGG - Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003421602 6:5963409-5963431 CTGCAAGGATTGGGGCAACATGG - Intergenic
1004901267 6:20196424-20196446 TTGCCAGGATTGAGGAAGAAGGG + Intronic
1005528174 6:26673198-26673220 CTGCAAAGAAGGAGGAAAAAAGG - Intergenic
1005542621 6:26828441-26828463 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1006180314 6:32150269-32150291 CTGGTAGGATAGAGGAACAAGGG - Intronic
1006510260 6:34517550-34517572 CTGCCAGGCTTGAGGAGCAAGGG - Intronic
1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG + Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009013436 6:57870558-57870580 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1009897702 6:69773811-69773833 ATGCTAGTGTTGATGAAAAATGG - Intronic
1010011910 6:71057697-71057719 ATGCTAGGCTTGATGAAGAATGG + Intergenic
1012014594 6:93834793-93834815 CTGCTAGGAGTGAAGGAGAAGGG + Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1013185917 6:107757920-107757942 CTGCGAGGTGTGAGGAAAAAGGG - Intronic
1013958762 6:115872330-115872352 ATGCTTTGAGTGAGGAAAAATGG - Intergenic
1015738639 6:136428936-136428958 CTGCTAAGATTGTAGAGAAAGGG - Intronic
1016728548 6:147402779-147402801 CTGCAAGGATATAGAAAAAAGGG - Intergenic
1021824862 7:24539706-24539728 GTGTGAGGATTGAGGAGAAAGGG - Intergenic
1022020065 7:26390482-26390504 CTGCTAGGATTCATAAAAATTGG - Intergenic
1022241107 7:28513400-28513422 CTACTAGGATTAAGCAAACACGG - Intronic
1023376914 7:39565949-39565971 CTGTTAGGATTGTGGAGTAAAGG - Intergenic
1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG + Intronic
1028467798 7:91172481-91172503 CTTCTAGCAGTGAGGAAAATGGG - Intronic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1030188030 7:106782256-106782278 CTGACAGGATAGAAGAAAAAGGG - Intergenic
1030408898 7:109149243-109149265 CTGGTGAGAATGAGGAAAAAGGG - Intergenic
1031048046 7:116915432-116915454 CTCCTAAGATAGAGTAAAAATGG - Intronic
1031538206 7:122960801-122960823 CTGTTAGGAGTAAGGAAAAGAGG + Intergenic
1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG + Intergenic
1032660775 7:133981607-133981629 CTGGTAAGGTTGTGGAAAAAAGG + Intronic
1032928669 7:136639352-136639374 ATGCTAGGATTAAATAAAAATGG + Intergenic
1036188030 8:6642301-6642323 TTGCCAGGACTGAGGAAAGAGGG + Intronic
1036609043 8:10334072-10334094 CTGCAAGCAGGGAGGAAAAAAGG + Intronic
1036624008 8:10450520-10450542 CTGGTAGGATGGAGGTAAAGTGG + Intergenic
1036718819 8:11153295-11153317 CTGTTAGAAGTGAGGAAATATGG + Intronic
1037578039 8:20226345-20226367 CTGGTAGGGTTGGGGAGAAATGG - Intronic
1038355416 8:26824617-26824639 ATGCTGGCATTGAGCAAAAAGGG - Intronic
1040104355 8:43533163-43533185 CTCCTAGGACTGAAGAAAACTGG + Intergenic
1040932596 8:52750487-52750509 CTGCTAGGAACAGGGAAAAATGG + Intergenic
1042367845 8:67956952-67956974 CTTCTACGAATGAAGAAAAAGGG - Intronic
1043334928 8:79163672-79163694 CAGTTAGGAATGAGGAGAAAAGG - Intergenic
1043708238 8:83379916-83379938 CTGCTAGGAGTAAAGAAGAAAGG + Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1046439848 8:114242601-114242623 CTGCTAGGAGTGAAGGAGAAGGG - Intergenic
1049027234 8:140001770-140001792 CTGCTAGTAGTGATGGAAAATGG + Intronic
1049843552 8:144788979-144789001 CTGCTGGGATTGCTGAACAAAGG - Intergenic
1050506242 9:6352297-6352319 ATGCTAGGTTTGATGAAGAATGG - Intergenic
1051331568 9:16029516-16029538 CTGCTAAGGTTGAGGGAATAGGG + Intronic
1051803646 9:20965693-20965715 TTGCTAGGATCTTGGAAAAATGG - Intronic
1051924987 9:22314368-22314390 CTGGAAGAATTGAGTAAAAAGGG + Intergenic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1058164811 9:101607277-101607299 CTGCTAGAAATGGGGGAAAAAGG + Intronic
1059110436 9:111554236-111554258 CTGGGAGCATTGTGGAAAAATGG + Intronic
1060319634 9:122544947-122544969 ATGCTTGAATTAAGGAAAAAAGG - Intergenic
1185891605 X:3827180-3827202 CTGCCAGGGTTGGGGAAAAAGGG + Intronic
1185896716 X:3865595-3865617 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1185901834 X:3904022-3904044 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1188747574 X:33864933-33864955 CTCTTTGGATTGAGGAAAATGGG - Intergenic
1189615261 X:42776686-42776708 CTGGGAGGACTGAGGAACAAAGG + Intergenic
1193523758 X:82563365-82563387 CTGCTAAGGTTGTGGAGAAAAGG + Intergenic
1194551576 X:95307438-95307460 CAGCTAGGAATGGAGAAAAATGG + Intergenic
1194651283 X:96517638-96517660 CTGAGATGATTGAGGAAAATTGG + Intergenic
1197107221 X:122731248-122731270 CTGGTAGGATTGTAGAGAAAAGG + Intergenic
1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG + Intronic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199377332 X:147129043-147129065 CTGGCAGGATTGTGGAGAAAAGG - Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1201360168 Y:13138177-13138199 GTGGTAGAATTGAGGAACAAAGG + Intergenic