ID: 1003292265

View in Genome Browser
Species Human (GRCh38)
Location 6:4789483-4789505
Sequence CCTAGGGCGGGGAGGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 357}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003292265_1003292274 -1 Left 1003292265 6:4789483-4789505 CCTGGCAGCCTCCCCGCCCTAGG 0: 1
1: 0
2: 0
3: 39
4: 357
Right 1003292274 6:4789505-4789527 GCATCTCCCCCACTCCCAGTGGG 0: 1
1: 0
2: 1
3: 18
4: 189
1003292265_1003292282 29 Left 1003292265 6:4789483-4789505 CCTGGCAGCCTCCCCGCCCTAGG 0: 1
1: 0
2: 0
3: 39
4: 357
Right 1003292282 6:4789535-4789557 TCCAGTGATTCAAACTTAAATGG No data
1003292265_1003292273 -2 Left 1003292265 6:4789483-4789505 CCTGGCAGCCTCCCCGCCCTAGG 0: 1
1: 0
2: 0
3: 39
4: 357
Right 1003292273 6:4789504-4789526 GGCATCTCCCCCACTCCCAGTGG 0: 1
1: 0
2: 1
3: 26
4: 232
1003292265_1003292275 3 Left 1003292265 6:4789483-4789505 CCTGGCAGCCTCCCCGCCCTAGG 0: 1
1: 0
2: 0
3: 39
4: 357
Right 1003292275 6:4789509-4789531 CTCCCCCACTCCCAGTGGGCAGG 0: 1
1: 0
2: 1
3: 33
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003292265 Original CRISPR CCTAGGGCGGGGAGGCTGCC AGG (reversed) Intronic
900149295 1:1171206-1171228 CCCAGGGAGGGGAGGCTGCAGGG + Intergenic
900162684 1:1231891-1231913 CCGAGCGCGGGGAGGCAGACCGG - Exonic
900676653 1:3891729-3891751 CCTCTGGCGGTGAGGCTGCACGG + Intronic
900888520 1:5432375-5432397 CCTGGGGTGGGCAGGCTGGCTGG - Intergenic
901433924 1:9234816-9234838 CCTGGGGCGGGGTGGCGGCCGGG + Exonic
901704634 1:11064074-11064096 CCTAGAGCCTGGAGGCTGCCAGG - Intergenic
902720913 1:18303388-18303410 CCTCAGCTGGGGAGGCTGCCGGG - Intronic
903016802 1:20366722-20366744 CCGAGCGCGCGGAGGCTGCCGGG - Intergenic
903225894 1:21894157-21894179 CCTAGGGAGGGGAGGCTATCAGG + Intronic
903263535 1:22143418-22143440 CCTAGGCCCGGGCGGCGGCCGGG - Intronic
903386932 1:22933208-22933230 CCTCGGGCAGGGAGGAAGCCTGG - Intergenic
903446699 1:23426919-23426941 CTTAGGGATGGGAGGGTGCCTGG + Intergenic
903788291 1:25875555-25875577 CTTGGGGCGGGGCCGCTGCCCGG - Intergenic
904745613 1:32708964-32708986 CCTTGGGTGGGGACCCTGCCTGG - Intergenic
904771220 1:32882433-32882455 CCTAGGGCGGCAGAGCTGCCAGG - Intergenic
904954653 1:34272924-34272946 CTTTGGCCTGGGAGGCTGCCTGG + Intergenic
905226631 1:36483059-36483081 CCCAAGGCAGGAAGGCTGCCCGG - Exonic
905797347 1:40823190-40823212 CCTAGGGCTGGGAGGGCGCAGGG - Intronic
906530731 1:46522519-46522541 TCCAGGCCGGGGAGGCTGCGTGG + Intergenic
907216623 1:52869981-52870003 TCCCGGGCGGGGCGGCTGCCGGG + Intronic
908442255 1:64166831-64166853 GTGAGGGCTGGGAGGCTGCCCGG + Intronic
909691083 1:78409003-78409025 CCTAGGCAGAGGAGGCTCCCCGG - Intronic
913017859 1:114757574-114757596 GCTCGGGCGCGGAGGCTGCTGGG - Intronic
913022803 1:114804567-114804589 TCCCGGACGGGGAGGCTGCCAGG + Intergenic
913131088 1:115838875-115838897 CCTCGGGCGCCGCGGCTGCCGGG - Exonic
913250740 1:116910336-116910358 CCTGGGGCGCCGAGGGTGCCCGG + Intronic
915339312 1:155167564-155167586 CCTAGGGCGGGGAGGGGGGAAGG - Intergenic
917855327 1:179094800-179094822 CCTAGGAGGTGGAGGCTGCAAGG + Intronic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
923370008 1:233300496-233300518 CCTAGGGTGGGCATTCTGCCTGG + Intergenic
923554137 1:234987337-234987359 CCTAGGCAGGGGTGGATGCCGGG + Intergenic
1062897576 10:1116135-1116157 CCTGGGGCGGGGTGGATGACGGG - Intronic
1064623525 10:17239635-17239657 CCTAGGGTTAGGAGGCTGCGGGG - Intergenic
1067295157 10:44971452-44971474 TGGAGGGCAGGGAGGCTGCCAGG + Intronic
1067848390 10:49740180-49740202 CCTGGGGGCGGGGGGCTGCCTGG + Intronic
1068006024 10:51393055-51393077 TCTCAGGCGGGGCGGCTGCCGGG + Intronic
1070554252 10:77515824-77515846 CCCTGGGCTGGGAGGCTTCCCGG + Intronic
1071616468 10:87080737-87080759 CCTCAGACGGGGCGGCTGCCAGG - Intronic
1071997592 10:91163103-91163125 CGTCGGGCGGGGAAGCCGCCTGG - Intronic
1072291751 10:93970920-93970942 CCCCGGACGGGGTGGCTGCCGGG - Intergenic
1073025478 10:100484285-100484307 CCTAGGGCAAGGAAGCTGGCTGG - Intergenic
1074065182 10:110007634-110007656 CCTGGTTCGGGGCGGCTGCCTGG - Intronic
1075879911 10:125842198-125842220 CCTACTGCAGGGAGGCTGGCAGG - Intronic
1076215236 10:128687885-128687907 CCTAGGGAGGGGAGAATGTCAGG + Intergenic
1076244506 10:128936011-128936033 CCTGGGTCGGGGAAGCTTCCGGG - Intergenic
1076307788 10:129476961-129476983 CCACAGGCGGGGAGGCTGCGAGG - Intronic
1076636608 10:131885332-131885354 GGCAGGGCGCGGAGGCTGCCTGG - Intergenic
1076700316 10:132269580-132269602 CCAAGGGCAGGAAGGCTGCTCGG + Intronic
1076717566 10:132374238-132374260 TATGGGGCGGGGAGGCTGCAGGG + Intronic
1076909749 10:133381069-133381091 CCTGTGGCAGGGTGGCTGCCAGG + Intronic
1077168145 11:1152929-1152951 CCCAGGGCGGGGACAGTGCCGGG - Intergenic
1077265658 11:1648298-1648320 CTGAAGGCGGGGAGGCGGCCCGG + Intergenic
1077311654 11:1891493-1891515 CCCAGGGTGGGCAGGCTGCTTGG + Intronic
1077394429 11:2314221-2314243 AACAGGGCGGGGAAGCTGCCTGG + Intronic
1077645188 11:3917250-3917272 CCCAGGGCTGGGAACCTGCCTGG - Intronic
1078577182 11:12512445-12512467 CCTGGGGCTGGGAGGGTGCGAGG - Intronic
1079156395 11:17951955-17951977 ATTAGGGCAGGGAGGCTACCTGG - Intronic
1081738587 11:45422447-45422469 ACTAGGGCATGGAGCCTGCCAGG + Intergenic
1082678820 11:56143825-56143847 TCTCAGACGGGGAGGCTGCCGGG - Intergenic
1083150568 11:60789387-60789409 ACTAGGGCTTGGGGGCTGCCTGG - Intronic
1083748105 11:64746131-64746153 CCGGGGGCGGGGCGTCTGCCTGG - Intergenic
1083931863 11:65850601-65850623 CCTTGGGTGGGGAGGCACCCAGG + Intronic
1084534263 11:69747417-69747439 TCAAGGGCAGGGAGGCAGCCTGG + Intergenic
1084955407 11:72688709-72688731 CCTAGGGCTGGGAGGTTGGTTGG - Intronic
1085308152 11:75500107-75500129 CCAGGGGCAGGGAGGGTGCCTGG - Intronic
1085474480 11:76781367-76781389 GCTTGGGAGGGGAGGGTGCCCGG - Intergenic
1089004865 11:115082850-115082872 CCTGGGGATGGGAGGATGCCTGG + Intergenic
1090152790 11:124403389-124403411 TCTCGGACGGGGCGGCTGCCGGG + Intergenic
1090435513 11:126683774-126683796 CCAAGAGAGAGGAGGCTGCCAGG - Intronic
1091634690 12:2187908-2187930 CTGAGGGCGAGGAGGATGCCAGG + Intronic
1092172882 12:6384430-6384452 CCTGGGGCTGCGATGCTGCCAGG - Exonic
1096116801 12:49059930-49059952 CCTAGGACTGAGAGGCCGCCCGG - Intergenic
1096178134 12:49536560-49536582 CCTAGGGCTGGGAGACTGTCAGG + Intergenic
1096990863 12:55801691-55801713 CCCAGGAGGGGGAGGCTGCAGGG - Intronic
1101150326 12:101877587-101877609 CTGCGGGCGGCGAGGCTGCCGGG - Exonic
1102513094 12:113428851-113428873 CCTAGGGTTGGGAGGCTGGTAGG - Intronic
1103913384 12:124363847-124363869 CCCAGGGTGGGGGGGCTGCCCGG + Intronic
1104723257 12:131058326-131058348 CCCAGGGCGGGTCGGCTGCTTGG + Intronic
1104861445 12:131926380-131926402 TCCAGGACGGGGTGGCTGCCGGG + Intergenic
1104897052 12:132169483-132169505 CCCAGGGCGGGGACGCTGAGGGG + Intergenic
1105326402 13:19374166-19374188 CCTAGGGTGTGTAGGGTGCCAGG - Intergenic
1105867097 13:24470819-24470841 CCTAGGGTGTGTAGGGTGCCAGG + Intronic
1105882650 13:24617541-24617563 CCTGCGTCTGGGAGGCTGCCTGG + Intergenic
1108586080 13:51871040-51871062 CCTATGGTGGGGAGGGGGCCAGG - Intergenic
1111918153 13:94383193-94383215 CATAGGGTGGGGAGGCTGGATGG + Intronic
1113835457 13:113325877-113325899 CCTGGGGCGGGCGGGCCGCCAGG - Intronic
1113925347 13:113938894-113938916 CCTGGGGCCAGGAGGCTTCCTGG - Intergenic
1114525435 14:23364977-23364999 ACCAGGGAGTGGAGGCTGCCGGG - Intronic
1115137371 14:30127189-30127211 GCTAGGTTGGGGAGGCTGGCAGG - Intronic
1116972572 14:51081955-51081977 CCCAGGGCAGGGAGGGTGGCTGG - Intronic
1117312574 14:54542646-54542668 CCTAGGGCTGGGAGGATGGAGGG - Intergenic
1118019469 14:61695882-61695904 CCCAGGGCGGGCAGGCGGGCGGG - Intronic
1118253259 14:64183112-64183134 TCTCGGACGGGGCGGCTGCCGGG + Intronic
1119130967 14:72172997-72173019 CCTGGGGCAGGGCTGCTGCCAGG + Intronic
1119388274 14:74272603-74272625 CCTAGGAGGTGGAGGCTGCAGGG + Intergenic
1119824003 14:77642009-77642031 CCAAGGGCGGGGAGGATGCGCGG + Intergenic
1120055436 14:79918593-79918615 ACTAAGGAGGGGAGGCTTCCAGG + Intergenic
1122271830 14:100571739-100571761 CCTAGCGAGGGGAGGCTGCTGGG - Intronic
1122406291 14:101503150-101503172 CCTAGGGAGACGAGGCTGGCAGG - Intergenic
1122831290 14:104397653-104397675 CCTGGGGCGGGGAGCTTCCCTGG - Intergenic
1125501514 15:40242662-40242684 CCCAGGGCGAGCAGTCTGCCTGG + Intronic
1125669794 15:41462677-41462699 CCTAGGGCTGGGAGGCTTATGGG - Intronic
1126105470 15:45144272-45144294 CCAAGGCCAGGGAGGCAGCCAGG + Intronic
1127072923 15:55302953-55302975 TCTTGGACGGGGTGGCTGCCGGG - Intronic
1127588165 15:60397706-60397728 CCTCGGGCCGGGAGGGTGCAGGG - Intronic
1127606344 15:60591951-60591973 CCTAGGTCGGGGAGGCGCCGCGG - Intronic
1127996915 15:64158517-64158539 GCTAGGGCAGGCAGGCTGCTGGG - Intronic
1129056498 15:72824102-72824124 CCTAGAGATGAGAGGCTGCCTGG + Intergenic
1130192498 15:81750256-81750278 TCCCGGGAGGGGAGGCTGCCTGG + Intergenic
1130273809 15:82466108-82466130 CCTAGGACGTTGAGGCTGCAGGG + Intergenic
1130466157 15:84193480-84193502 CCTAGGACGTTGAGGCTGCAGGG + Intergenic
1130498106 15:84480056-84480078 CCTAGGACGTTGAGGCTGCAGGG - Intergenic
1130588449 15:85198075-85198097 CCTAGGACGTTGAGGCTGCAGGG + Intergenic
1130966988 15:88705188-88705210 GCAGGGGCGGGGAGGCTGACGGG + Intergenic
1131822291 15:96285551-96285573 CCTGTGGCCTGGAGGCTGCCTGG + Intergenic
1132522561 16:398200-398222 CCTCTGGAGGGGACGCTGCCAGG - Intronic
1132623743 16:880274-880296 CCTTGGCCTGGGAGGCTTCCAGG - Intronic
1132864981 16:2088828-2088850 CCGAGGGCCTTGAGGCTGCCTGG + Exonic
1132897317 16:2235160-2235182 GCGGGGGCGGGGAGGCTCCCTGG + Intronic
1133064091 16:3193671-3193693 CCTAGGAAGTGGAGGCTGCAGGG - Intergenic
1133264853 16:4576831-4576853 CTTAGGGCAGGGAGGCTGTTAGG + Intronic
1136172188 16:28496006-28496028 CCTCAGGCGGGGAGGAGGCCGGG + Exonic
1136172199 16:28496033-28496055 CCTCGGGAGGGGAGGAGGCCGGG + Exonic
1136687332 16:32003040-32003062 CCTGGGGCGGGGCAGCTGCATGG - Intergenic
1136919060 16:34246142-34246164 TCTCAGGCGGGGTGGCTGCCGGG + Intergenic
1136933447 16:34437662-34437684 CCTAGGCCTGGGTGGCCGCCGGG - Intergenic
1136971125 16:34974152-34974174 CCTAGGCCTGGGTGGCCGCCGGG + Intergenic
1137401473 16:48157058-48157080 CCCAGGCCGGGGAGCCTTCCTGG - Intergenic
1137673730 16:50293564-50293586 GATAGGGCGGGGAGGCCGCCTGG - Intronic
1137701942 16:50503694-50503716 CCCAGGGAGGGGCGGGTGCCAGG + Intergenic
1138037801 16:53625538-53625560 CCCAAGACGGGGTGGCTGCCGGG - Intronic
1138079126 16:54072093-54072115 CCCAGGGCCAGGAGGCTGCTGGG + Intronic
1139483029 16:67241193-67241215 CCTGGGGAGGGCAGGCAGCCAGG - Intronic
1139752617 16:69118930-69118952 CCTAGAGTGGGGAGCCTCCCTGG - Exonic
1140054806 16:71516426-71516448 GCGAGGCCGGGGAGGCTGCGGGG + Intronic
1140223058 16:73058077-73058099 CCGAGGGCGGGAGGGCGGCCGGG - Intronic
1140954488 16:79849411-79849433 GCTGGGGCGGAGAGGCTACCTGG + Intergenic
1142005399 16:87687438-87687460 TCTCGGGCTGGGAGGCTGCCAGG - Intronic
1142293169 16:89201839-89201861 CATAGGGCGGGGAGGTTGAGGGG + Intergenic
1142309176 16:89302202-89302224 CCCTGGGCCGGGAGGCTGCTGGG - Intronic
1142711108 17:1724603-1724625 GGGAGGGCGGGGAGGCCGCCGGG + Intronic
1144536383 17:16095364-16095386 TCCCGGGCGGGGTGGCTGCCGGG - Intronic
1144574001 17:16417646-16417668 CCTAGGAGGAGGAGGCTGCTCGG - Exonic
1144692964 17:17280907-17280929 CCGAGGGAGGGGAGGCCGGCCGG + Intronic
1144888178 17:18477893-18477915 CTGAGGGCAGGGAAGCTGCCAGG + Intronic
1145144028 17:20466410-20466432 CTGAGGGCAGGGAAGCTGCCAGG - Intronic
1145418146 17:22741389-22741411 TCCCGGGCGGGGTGGCTGCCGGG - Intergenic
1145761763 17:27429540-27429562 CCTGGTGTGGGGAAGCTGCCTGG - Intergenic
1146277752 17:31525853-31525875 CCGAGGCCGAGGAGGCCGCCTGG + Intronic
1147852197 17:43451971-43451993 TCTCTGACGGGGAGGCTGCCGGG - Intergenic
1147907318 17:43831807-43831829 GCCAGGGCCTGGAGGCTGCCAGG + Intronic
1147973892 17:44236774-44236796 CCCAGGGCTGGCAGGCTGCAGGG - Intergenic
1148645462 17:49217632-49217654 GCTGGGGGGGGGAGGCAGCCAGG - Intronic
1148751680 17:49948923-49948945 CAGAGGGAAGGGAGGCTGCCAGG + Intergenic
1149546846 17:57510220-57510242 CCTTGGGTGGGGAGGGTGCCTGG + Intronic
1151657277 17:75501931-75501953 CCTTGGGCTGGAAGGCTGCTGGG + Exonic
1151689559 17:75673562-75673584 CTTAGGGCTGGAAGGCTTCCTGG + Intronic
1152188788 17:78875701-78875723 GCTGGGGCTAGGAGGCTGCCTGG - Intronic
1152281107 17:79385276-79385298 AGCAGGGCGGGGAGGCTGCAAGG + Intronic
1152352503 17:79791456-79791478 CCTGGGCCGGAGAGGCTGCGGGG + Intergenic
1152911920 17:83010020-83010042 CCTGGTGTGGGGGGGCTGCCCGG + Intronic
1153301531 18:3596119-3596141 GCTAGGGCAGGGAGAGTGCCAGG + Intronic
1154039404 18:10838874-10838896 GATAGGGAGGGGAGGTTGCCTGG - Intronic
1154158200 18:11959967-11959989 TCCCGGGCGGGGTGGCTGCCGGG - Intergenic
1154194428 18:12254998-12255020 CCAAGGGCGGAGACGCTGCCTGG + Intronic
1157449975 18:47778770-47778792 CCTAGGGCTGGGAGGGTGGAGGG + Intergenic
1158954368 18:62524408-62524430 GCGAGGCCGGGGAGGCCGCCGGG - Intronic
1160052167 18:75444054-75444076 ACTAGGGTGGGGAGGCTGCTTGG - Intergenic
1160246627 18:77164960-77164982 TCTCAGGCTGGGAGGCTGCCAGG + Intergenic
1160514819 18:79472422-79472444 CCTGGGAAGGAGAGGCTGCCGGG - Intronic
1161114189 19:2487881-2487903 CCTAGAGCTGGGAAGCTGCAGGG - Intergenic
1161479455 19:4503357-4503379 CCCAGGTCGTGGAGGCTGGCAGG - Exonic
1161586067 19:5106556-5106578 CAGAGGGAGGGGTGGCTGCCGGG - Intronic
1161689160 19:5720826-5720848 CCTGGGGCTGGGGTGCTGCCGGG + Intronic
1162014667 19:7838686-7838708 CCTAGGGCAGGCAGGCAGGCAGG + Intronic
1162775161 19:12974991-12975013 CGTGGGGCGGGGAGCCGGCCAGG + Intergenic
1163630495 19:18415796-18415818 TTTAGGGCAGGGAGGTTGCCAGG - Intergenic
1163945492 19:20530424-20530446 TCCTGGGCGGGGTGGCTGCCGGG + Intergenic
1164040223 19:21487050-21487072 TCTCAGACGGGGAGGCTGCCGGG + Intronic
1164792873 19:31002916-31002938 TCCAGGGCTGGGAGGGTGCCAGG + Intergenic
1165227861 19:34366790-34366812 CCAGGGGCGTGGAGGCCGCCCGG + Exonic
1165266712 19:34667396-34667418 CCTGGGCCGGACAGGCTGCCTGG - Intronic
1165768303 19:38364158-38364180 TCCAGGACGGGGTGGCTGCCGGG + Intronic
1166387307 19:42389424-42389446 CCCAGGGGAGGGAGGCGGCCAGG + Intronic
1166979897 19:46626096-46626118 TTTTGGGCTGGGAGGCTGCCTGG - Intergenic
1167199418 19:48054036-48054058 CCTTGGGCCTGGAGGATGCCAGG - Intronic
1168325295 19:55535955-55535977 CCCAGGCTGGGGAGGCTGGCAGG - Intronic
925367551 2:3321103-3321125 CCCTGGGCCGGGAGGCTGCGTGG - Intronic
926206904 2:10840320-10840342 CCTGGGGCGGGGATGCTGTTGGG + Intergenic
926334225 2:11851032-11851054 CCTTGGGCTGGGAGAGTGCCAGG + Intergenic
927698302 2:25252142-25252164 CCGGGGGCGGGGAGGCGGCAGGG - Intronic
927787165 2:25982048-25982070 CCTAGGGTGGGGACGCTGGGAGG + Exonic
927818917 2:26245075-26245097 CCCAGGGAGGGGAGGGGGCCGGG - Intronic
929904562 2:46034687-46034709 CCCAGGGCGGGGATCCTGTCTGG + Intronic
930665605 2:54096149-54096171 TCTCGGACGGGGCGGCTGCCGGG + Intronic
930873513 2:56189869-56189891 ACAAAGGCAGGGAGGCTGCCTGG + Intronic
931052310 2:58428512-58428534 CCGGGGGCGGGGAGGCAGCGGGG - Intergenic
931348961 2:61471258-61471280 CCGAGGGCGGGGAGGCCGGACGG - Intergenic
931584272 2:63809181-63809203 TCCCGGGCGGGGCGGCTGCCGGG - Intronic
931770645 2:65494398-65494420 GCTGGGGCGGGGGGGTTGCCTGG - Intergenic
932245170 2:70190752-70190774 GCTCGCGCGGGGAGGATGCCGGG - Intronic
932247679 2:70209207-70209229 CCTAGGAGGGGGAGGTTGCAGGG + Intronic
932607590 2:73175548-73175570 CCTGGGCCCGGGAGGCTGTCAGG - Intergenic
934576632 2:95405848-95405870 CCCAGAGCGGGGAGGGTGCAGGG - Intronic
934794797 2:97091395-97091417 CCCAGAGCGGGGAGGGTGCAGGG + Intronic
936031958 2:109079753-109079775 CCTGGGTTGGGGAGGCTCCCTGG + Intergenic
936093196 2:109513956-109513978 CCCAGGCCCAGGAGGCTGCCTGG - Intergenic
936510036 2:113137842-113137864 CCTAGGGAGGAGAGGTTGCTTGG - Intergenic
936713717 2:115161773-115161795 CCTACGACGGGGAGCCCGCCCGG + Exonic
937043063 2:118835901-118835923 CCTGGCGCGGGGAGGCGGCCGGG + Intergenic
937917563 2:127106504-127106526 CCAAGGGCCGGGAGGCTGGGAGG - Intronic
938262187 2:129903983-129904005 CCCAGGGCAGCGAGGGTGCCTGG + Intergenic
943578053 2:189653696-189653718 TCTTGGACGGGGCGGCTGCCTGG - Intergenic
943587719 2:189760354-189760376 CCTAAGACGGGGCGGCTGCCGGG + Intronic
944831106 2:203534950-203534972 CCTGGGGCGGGGTCGTTGCCAGG - Intronic
946690296 2:222304252-222304274 CCTAGGGCGGGCAGCCCTCCCGG - Exonic
947611967 2:231530266-231530288 CCTAGGGCGGGAAGGGTCCGAGG - Intronic
947625154 2:231614294-231614316 GCTAGGGCGGCGAGTCTGCCGGG + Intergenic
948712290 2:239832777-239832799 CCCAGGGCAGGGAGGCCGGCAGG + Intergenic
948729398 2:239953479-239953501 CCCAGGGAGGGGTGCCTGCCGGG + Intronic
948777255 2:240296180-240296202 CCTCGGGTAGGGGGGCTGCCGGG - Intergenic
1169324629 20:4665239-4665261 CCTAGGGAGGGGAGGCCACAGGG - Intergenic
1171035004 20:21707111-21707133 CCTGGGGCGGGCAGGCTTGCAGG + Intronic
1171208277 20:23297982-23298004 CCTAGGAAGGGGAGGCTCCCTGG + Intergenic
1172201240 20:33127611-33127633 CCAGGGGTGGGCAGGCTGCCTGG - Intergenic
1172296010 20:33811650-33811672 ACAAGCGCGGTGAGGCTGCCCGG + Exonic
1172882899 20:38213260-38213282 CCTGGGGTGGAGAGCCTGCCTGG + Exonic
1173245044 20:41331072-41331094 GCTAGAGAGGGGAGGCTGCATGG - Intergenic
1173729449 20:45318219-45318241 CCTAGGGTGGGTAGGCTGGTGGG - Intergenic
1174576725 20:51542504-51542526 CGCAGGGCGGGAAGGCTGCGGGG + Exonic
1175184825 20:57173146-57173168 CCTGGGCCGGGCAGGCTGCGGGG - Intronic
1175222907 20:57427578-57427600 CCTGAGGCAGGGACGCTGCCTGG - Intergenic
1175531436 20:59676059-59676081 CTTAGATCAGGGAGGCTGCCTGG - Intronic
1175782413 20:61690936-61690958 CCTGGGGCGGGGGGTCTGCAAGG - Intronic
1176116608 20:63434331-63434353 CCCAGGGCGGGGACTCAGCCCGG + Intronic
1176121054 20:63454771-63454793 CCTCGGGAGAGGAGGCTCCCCGG + Intronic
1179908081 21:44434435-44434457 ACTATGGCGGGGATGCTGCTGGG + Intronic
1180032967 21:45224628-45224650 CCCTGGGCGGGGTGGCTGTCAGG + Exonic
1180232533 21:46435994-46436016 CCTAGGTGGAGGCGGCTGCCAGG - Exonic
1180670498 22:17548967-17548989 CCTTGGTGGGGGAGGCTGACTGG - Exonic
1181519582 22:23437381-23437403 CCTGGGGCGGGGAGGAGGCTGGG - Intergenic
1182692140 22:32171548-32171570 CCTAGAGCGGGGAAGGTTCCTGG - Intergenic
1183595240 22:38807174-38807196 TCCCGGGCGGGGTGGCTGCCGGG - Intergenic
1183960828 22:41410979-41411001 CCTGGGGCAGAGAGGCTGCCAGG + Intergenic
1184339810 22:43880096-43880118 CCTGGGGCAGAGAGGATGCCAGG - Exonic
1184698162 22:46150915-46150937 CCTAGCGCTGGGGGCCTGCCCGG + Intronic
1184781414 22:46651534-46651556 CACAGGGATGGGAGGCTGCCCGG - Intronic
1185028844 22:48431181-48431203 CGGAGGGTGGGAAGGCTGCCGGG + Intergenic
949980815 3:9500773-9500795 CCCAGGGCAGGGAGGCTCCCCGG + Exonic
951550512 3:23871529-23871551 TCTCGGACGGGGTGGCTGCCGGG + Intronic
952316777 3:32238703-32238725 GCGAGCGAGGGGAGGCTGCCGGG - Exonic
953850868 3:46464677-46464699 CCTACAGCCGGGAGGCGGCCCGG - Intronic
954304906 3:49720489-49720511 CCTAGGTAGGGGAGGGTGCAAGG - Exonic
955172992 3:56584168-56584190 TCCCGGGCGGGGCGGCTGCCGGG + Intronic
955393057 3:58535217-58535239 CCTAGGGCTGGGTGTCAGCCAGG + Intronic
960943943 3:122953255-122953277 CCTGGGGCGGGGAGGCAGAGAGG - Intronic
961558177 3:127710886-127710908 CCTTGGGCGCAGCGGCTGCCTGG - Intronic
961742220 3:129040021-129040043 CCGAGGAAGGGGTGGCTGCCAGG - Exonic
961823914 3:129588874-129588896 CCTGGGACGGGGTGGCTGGCAGG + Intronic
962314655 3:134351515-134351537 GCTGGAGAGGGGAGGCTGCCAGG + Intergenic
962481711 3:135803672-135803694 CCATGGGAGGGCAGGCTGCCTGG + Intergenic
962747843 3:138410771-138410793 CTGAGGGAGGGGAGGCAGCCGGG + Intergenic
963249094 3:143086824-143086846 TCTCGGACGGGGCGGCTGCCGGG + Intergenic
964747594 3:160026694-160026716 ACCAGGTCCGGGAGGCTGCCGGG + Exonic
965757628 3:172040900-172040922 CCTTTGGCGGGGAGGCTTCCAGG + Intronic
966118950 3:176500604-176500626 TCCAGGCCTGGGAGGCTGCCTGG + Intergenic
966787737 3:183636070-183636092 GCTAGGGCGGGGTGGTTGCCGGG + Intronic
967365141 3:188677857-188677879 CCTAGGTCTGGGTGGTTGCCTGG + Intronic
968228533 3:196990809-196990831 ACTAGGGCAGGGAGGCTGCGGGG + Intronic
968903739 4:3442550-3442572 CCGAGGGCGGGGAAGGTGTCAGG + Intronic
968934223 4:3601572-3601594 CCTTGGCCTGGGAGGCAGCCTGG - Intergenic
969398521 4:6938550-6938572 CCTGGGGAGGGGGAGCTGCCAGG - Intronic
969650897 4:8467305-8467327 ACTAGGACGGTGCGGCTGCCGGG + Intronic
969660286 4:8523387-8523409 CCTTGAGCTGGGAGGGTGCCAGG + Intergenic
970596660 4:17606412-17606434 CCCAGGACGGGGAGGTTGCAGGG - Intronic
972304740 4:37820589-37820611 TCCAGGACGGGGCGGCTGCCTGG - Intergenic
972726748 4:41751688-41751710 GCTTGGCCGGGGAGGGTGCCCGG + Intergenic
974047006 4:56907166-56907188 GTGAGGACGGGGAGGCTGCCTGG - Intergenic
975650508 4:76588475-76588497 TCTAGGAGGGGGAGGCTGCGTGG - Intronic
979487150 4:121283123-121283145 TCTAGGGTAGGGAGCCTGCCGGG - Intergenic
981606740 4:146547543-146547565 CCTGGGCAGGGGAGGCTCCCTGG + Intergenic
981994873 4:150964060-150964082 TCCCGGACGGGGAGGCTGCCGGG - Intronic
982157495 4:152536203-152536225 CCCAGGGCGGGGTGGCTGGAAGG - Intergenic
983415340 4:167444998-167445020 CCTAGTGGGATGAGGCTGCCAGG - Intergenic
992558823 5:77929934-77929956 CCTGGTGCGGGGAGGCTGGCAGG - Intergenic
994123438 5:96143551-96143573 CCCAGGGCGGGTAGAGTGCCTGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996373213 5:122775003-122775025 CCGGGGGCGGGGAGGCTGGCGGG + Exonic
997442624 5:133919285-133919307 CCTGGGGCAGGGGGGCTGTCAGG + Intergenic
999389971 5:151182787-151182809 CCTCAGCTGGGGAGGCTGCCTGG + Exonic
1000037436 5:157460049-157460071 CCTGGGGTGAGGACGCTGCCAGG - Exonic
1001019937 5:168174248-168174270 CCCAGGGAGGGGAGACAGCCTGG + Intronic
1001762981 5:174223057-174223079 CCTGGGGAGGGGAAGCTGCCTGG - Intronic
1001944836 5:175770419-175770441 CCCATGGCAGGGAGGCTGGCTGG - Intergenic
1002046358 5:176543578-176543600 CCAAGGTCACGGAGGCTGCCAGG - Intronic
1002296229 5:178232734-178232756 CCACGGGCCGGAAGGCTGCCAGG - Exonic
1002521525 5:179795441-179795463 CCTCGGGCGGGGAGGGGGCGGGG + Intronic
1002710488 5:181192034-181192056 CCTTGGGCGGGGCGGGGGCCAGG + Intergenic
1002924759 6:1599029-1599051 CCTGGGGAGCAGAGGCTGCCTGG - Intergenic
1003148552 6:3529340-3529362 CTTAGGGCAGCGAGGATGCCTGG - Intergenic
1003292265 6:4789483-4789505 CCTAGGGCGGGGAGGCTGCCAGG - Intronic
1005327849 6:24720153-24720175 GCTAGGGCGGGGTGGGTGACGGG + Exonic
1005644688 6:27827592-27827614 TCCAGGACGGGGTGGCTGCCGGG + Intergenic
1005813278 6:29531884-29531906 CCTAGAGTGGGGAAGCTGTCAGG - Intergenic
1006471991 6:34234934-34234956 CCAAGGCCGCGGAGGCTGCTAGG - Intergenic
1007290174 6:40779793-40779815 CCTGGTCCTGGGAGGCTGCCTGG - Intergenic
1007723932 6:43902801-43902823 CCTGGGGTGGGGAAGCAGCCTGG + Intergenic
1008332894 6:50263769-50263791 CCTAGGGTGGGGATGCTGCATGG - Intergenic
1008624743 6:53305397-53305419 TCCCGGGCGGGGTGGCTGCCGGG + Intronic
1010400617 6:75442030-75442052 TCTGGGACGGGGCGGCTGCCGGG + Intronic
1018909495 6:168093986-168094008 CCTAGAGAGGGGTGGCTCCCGGG - Intergenic
1019472302 7:1227482-1227504 CCCAGGGCGGGGAGGCAGGCAGG - Intergenic
1019591679 7:1838897-1838919 CCTGGGGCGGGGAGGAGGCTGGG + Intronic
1019597096 7:1863227-1863249 CCCAGGGCGGGGTGAATGCCGGG + Intronic
1019619053 7:1980628-1980650 CCCAGGGCGGGGGTGCTGCCAGG - Intronic
1020023590 7:4883495-4883517 CCTGGGGCGCGGAGGCCGCGGGG - Intronic
1020093182 7:5352767-5352789 CTTTGGGAGGGGAGCCTGCCAGG + Intronic
1020140193 7:5607603-5607625 CCGACGGCGGGGAGGATGCGGGG - Intergenic
1023831328 7:44040418-44040440 CCTAAGGGGAGGGGGCTGCCAGG - Intergenic
1023998944 7:45178477-45178499 CCAGGGCCGGGGAGGCTTCCTGG - Intronic
1024053334 7:45643892-45643914 CCTGAGGCAGGGAGGCTTCCGGG + Intronic
1024223016 7:47303107-47303129 CTCAGGGAGGGGTGGCTGCCCGG + Exonic
1024996047 7:55273833-55273855 GCAATGGCGGGAAGGCTGCCAGG - Intergenic
1026846074 7:73699845-73699867 CCTAGGCAGGGGAGGGAGCCTGG + Exonic
1027025836 7:74851270-74851292 CCTGGGGAAGGGAGGCCGCCCGG - Intronic
1027061925 7:75092849-75092871 CCTGGGGAAGGGAGGCCGCCCGG + Intronic
1029741658 7:102494724-102494746 CCTAAGGGGAGGGGGCTGCCAGG - Intronic
1029759649 7:102593893-102593915 CCTAAGGGGAGGGGGCTGCCAGG - Intronic
1029777017 7:102689803-102689825 CCTAAGGGGAGGGGGCTGCCAGG - Intergenic
1031047764 7:116912493-116912515 CCTAGGGCTGGGAGGGTTCTGGG - Intronic
1032156866 7:129476253-129476275 TCCCGGGCGGGGCGGCTGCCGGG + Intronic
1032179675 7:129664047-129664069 CCCAGGGCAGGGAGGTTGCAGGG + Intronic
1032589383 7:133177699-133177721 TCCAGGACGGGGCGGCTGCCGGG - Intergenic
1033601416 7:142891644-142891666 CCTTGGGCGCGGAGGCTCCGTGG - Intergenic
1034344847 7:150379628-150379650 CCGAGGGTGGGGAGGGCGCCAGG + Intronic
1034413986 7:150955517-150955539 CCCAGGGCAGGCAGGCTGCAGGG - Intronic
1034961871 7:155367860-155367882 CCCCGGACGGGGTGGCTGCCGGG + Exonic
1035062897 7:156082268-156082290 CCTGGGGCAGGAAGGCTCCCCGG - Intergenic
1035245748 7:157561160-157561182 CAGAGGGCGGGGAGACTGGCCGG - Intronic
1035299058 7:157885368-157885390 GCTAGGCCTGGGTGGCTGCCAGG - Intronic
1035446854 7:158949036-158949058 CTCAGGGCGCAGAGGCTGCCCGG - Intronic
1035732396 8:1862223-1862245 CCTGGGGCGGGGCGGCCGCCTGG + Intronic
1037820179 8:22131390-22131412 GCTAGGGCGGGGCGGCTGGGAGG + Exonic
1038620534 8:29138621-29138643 CCTGGGGGAGGGAGGCAGCCAGG - Intronic
1039835169 8:41250105-41250127 CCTTGGAGGGGGAGGCTGCCTGG + Intergenic
1040310987 8:46236744-46236766 CCTGGGGAGGGGGGGCTGCTGGG + Intergenic
1041167333 8:55102619-55102641 CCGAGGACGAGGAGGCGGCCGGG + Exonic
1042475699 8:69245854-69245876 CCCCGGACGGGGTGGCTGCCGGG - Intergenic
1042695124 8:71547528-71547550 CCTAGGCCTCGGAGGCTGCCCGG + Exonic
1044835592 8:96292524-96292546 CCTGAGGCTAGGAGGCTGCCAGG + Intronic
1047448264 8:124938965-124938987 CCTGGAGCCAGGAGGCTGCCGGG + Intergenic
1048227028 8:132597609-132597631 CCTTGGTCTGGGAGGATGCCAGG + Intronic
1048991842 8:139765137-139765159 CCAAGGGTGGGGCTGCTGCCTGG + Intronic
1049340861 8:142111982-142112004 CCTAGAGCGCAGAGGCTGCCTGG - Intergenic
1049501911 8:142971553-142971575 CCTAGGGGAGGGAGGCTGGGTGG - Intergenic
1049586101 8:143433038-143433060 CCTTGGGTTGGGAGGCTGGCGGG - Intergenic
1049673057 8:143878220-143878242 CCCAGGGCGGGAAACCTGCCCGG + Intronic
1051262733 9:15280643-15280665 CCAAGGGCCAGGAGGCTGCTTGG - Intronic
1052860821 9:33436834-33436856 CCTAGGCTGTGGAGGGTGCCAGG - Intergenic
1052881065 9:33601127-33601149 TCTCGGACGGGGTGGCTGCCGGG - Intergenic
1054455931 9:65430408-65430430 CCTTGGCCTGGGAGGCAGCCTGG + Intergenic
1057630456 9:96715636-96715658 CCTCGGACGGGGCGGCTGCCAGG + Intergenic
1058018822 9:100067873-100067895 TCTCAGGCGGGGCGGCTGCCGGG - Intronic
1058467804 9:105245546-105245568 CCGAGTGCGGGGAGGCCGCGGGG - Intronic
1058851210 9:109013494-109013516 CCTCGGGCGGGTGGGCTGACTGG - Exonic
1058911848 9:109527383-109527405 CCAGGGGCGGGGAGGTTGCAGGG + Intergenic
1059118115 9:111617492-111617514 TCCCGGGCGGGGTGGCTGCCGGG + Intergenic
1059327188 9:113511204-113511226 GCCAGGGCAGGGTGGCTGCCAGG + Intronic
1060661935 9:125409463-125409485 CCCAGGGCTGGGAGGCGCCCTGG + Intergenic
1061033683 9:128101815-128101837 CCTGGTGCGGGGCGGCTGCCAGG + Intronic
1061618928 9:131798340-131798362 CCTTGCTCTGGGAGGCTGCCTGG - Intergenic
1061859458 9:133460456-133460478 CCCAGGGCGGGGGGGCGGCGGGG + Intronic
1062229610 9:135474418-135474440 CCCAGGGCGGGGGAGCTGCATGG - Intergenic
1062276706 9:135734820-135734842 CCTGGGGCGGGGAGGAAGCTGGG - Intronic
1062332796 9:136051846-136051868 CCTGGGGCGGGGAGGGCGCAGGG + Intronic
1062345856 9:136114903-136114925 CCCAGGGCGTGGACGCAGCCCGG + Exonic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1062523975 9:136970875-136970897 GCTGGGGAGGGGAGGCTTCCTGG - Intronic
1185610121 X:1389355-1389377 CCGAGGCCTGGGAGACTGCCTGG - Exonic
1189284966 X:39845582-39845604 CCCAGGTGGGGGAGGCTCCCTGG + Intergenic
1189794749 X:44635134-44635156 CCTAGAGTGGGGAGCCTCCCTGG + Intergenic
1190598318 X:52067314-52067336 CCTGGGCCGGGGAGCCTGTCTGG + Exonic
1190610506 X:52186759-52186781 CCTGGGCCGGGGAGCCTGTCTGG - Exonic
1192201553 X:69069481-69069503 CCTAGGGCAGGGCTGCTGGCTGG - Intergenic
1193271051 X:79530679-79530701 CCTGGGGCCGGCAGGCTGCGGGG - Intergenic
1193654888 X:84187579-84187601 CCTTGGGCGGAGCGCCTGCCTGG - Intronic
1197452956 X:126641557-126641579 TCTCGGACGGGGTGGCTGCCGGG - Intergenic
1199182747 X:144878179-144878201 CCTAGGTTGGGGAGGCTCCCCGG - Intergenic
1199676878 X:150196576-150196598 CCTGAGGGGAGGAGGCTGCCTGG - Intergenic
1199764785 X:150933256-150933278 CCTAGGAGGCGGAGGCTGCAGGG + Intergenic
1200056715 X:153465433-153465455 GCGAGGCCGGGGAGGGTGCCAGG - Intronic
1200110107 X:153736646-153736668 CCCAGGACGGGAGGGCTGCCGGG + Intronic
1200211087 X:154346830-154346852 CCTAGGGCGGTGGCCCTGCCAGG + Intergenic
1200216273 X:154369464-154369486 CCCAGGGCTGGGAGACTGTCTGG + Intronic
1200219765 X:154385262-154385284 CCTAGGGCGGTGGCCCTGCCAGG - Intergenic
1200247675 X:154534667-154534689 CCCAGGGTGGGAAGGCTTCCCGG - Intronic
1202605389 Y:26635446-26635468 CCTAGGGTGGGTAGGGTGCCAGG + Intergenic