ID: 1003300358

View in Genome Browser
Species Human (GRCh38)
Location 6:4875160-4875182
Sequence CTGCTAGGATGCAGGACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003300358_1003300362 30 Left 1003300358 6:4875160-4875182 CCTGTTGTCCTGCATCCTAGCAG 0: 1
1: 0
2: 3
3: 13
4: 168
Right 1003300362 6:4875213-4875235 CTGTAGTAAGACTTGAATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003300358 Original CRISPR CTGCTAGGATGCAGGACAAC AGG (reversed) Intronic
900250369 1:1665679-1665701 CTGCTGGGGTGCAGGACATGGGG - Exonic
902114273 1:14108058-14108080 CGGCTAGAATGCAGGGTAACAGG - Intergenic
906478888 1:46187576-46187598 CTGCTAGGGTGCGGGACAGGGGG + Intergenic
907361994 1:53925013-53925035 CTTCTAGGAAGCAGGACTAGAGG - Intronic
915862752 1:159464237-159464259 TGGCAAGGATGCAGAACAACTGG - Intergenic
916522837 1:165580689-165580711 CTGCTAGGAAGAAGGAGAACTGG - Intergenic
917632540 1:176904316-176904338 CTGCTCGGCAGCAGGACAGCAGG - Intronic
922720115 1:227896027-227896049 CTGCTGGAATGCAGGAAACCAGG - Intergenic
923034789 1:230278239-230278261 CTGCAAGGAGCTAGGACAACAGG + Intronic
923596139 1:235362002-235362024 CTGCTTGGCTGTAGGACATCTGG - Intergenic
923800730 1:237205887-237205909 TTGGCAAGATGCAGGACAACTGG + Intronic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063417060 10:5882207-5882229 CTGCTCGAAAGCAGGACATCAGG + Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065249676 10:23797904-23797926 CTTCTAGGATTCATGAGAACTGG - Intronic
1065308673 10:24393441-24393463 CTGCTTTCATGCAGGACAGCAGG + Intronic
1065317625 10:24479728-24479750 ATGCTATGATGCAGCACAAAAGG - Intronic
1067201230 10:44173671-44173693 CTGCTGGGGTTCAGGACTACAGG + Intergenic
1070182875 10:74031366-74031388 CTGATAGGCTACAGGACAAGAGG - Intronic
1072021187 10:91403814-91403836 CTGTTAGAATGCTGGACAACAGG + Intergenic
1072294873 10:93999369-93999391 CAGCTAGTATGCAGGAGATCCGG + Intronic
1073056497 10:100706692-100706714 CTACCAGGATGCAGGACTTCGGG - Intergenic
1073124507 10:101141139-101141161 CAGCCAGGCTGCAGGGCAACCGG + Intergenic
1073610849 10:104941258-104941280 CTCCTGGGATGCAGCTCAACAGG + Intronic
1074679161 10:115886131-115886153 CTCATAGTATGCAGGACAAATGG + Intronic
1075467976 10:122665677-122665699 TTTCTAGGATGAAGGACACCTGG + Intergenic
1076266752 10:129114637-129114659 CTGCTTGGATGTAGGACGAAAGG + Intergenic
1076478909 10:130771497-130771519 CTGCTAGGATGCAGGTCAGCAGG - Intergenic
1076813251 10:132899856-132899878 CTGCAGGGATGCAGGGCAAGGGG + Intronic
1076999496 11:315655-315677 CTGCTAGGATCCAGCACACCTGG - Intergenic
1077114425 11:876935-876957 CAGCCTGGATGCAGGACCACTGG - Intronic
1080606246 11:33867314-33867336 CTAGTAGGATACTGGACAACAGG + Intronic
1081585814 11:44382836-44382858 CTGCTAGGATGTGGGACTAGGGG + Intergenic
1089891026 11:121880864-121880886 CTGCTGGGATAAAGGGCAACTGG + Intergenic
1090180273 11:124692261-124692283 CTGCTTGGATGTAGTACATCAGG - Intronic
1091661432 12:2386763-2386785 CTGCTGGGATGCAGAGAAACAGG - Intronic
1092257842 12:6936929-6936951 CTGCTTGGCTGTAGGACACCTGG - Exonic
1096773672 12:53951523-53951545 CTGCTAGGATGCAGGAGGGATGG + Intergenic
1097197651 12:57252498-57252520 CTGACAGGCTGCAGAACAACAGG + Intronic
1097318752 12:58202213-58202235 GTGCTAGGATGTAGGATATCAGG + Intergenic
1098713655 12:73801258-73801280 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1099012884 12:77312838-77312860 GTGCCAGGATGCAGGACATGGGG - Intergenic
1101353736 12:103957146-103957168 CTGCAGGGATGCTGGGCAACAGG + Exonic
1101820958 12:108184039-108184061 AGGCTGGGATGCAGGAAAACTGG + Intronic
1106552868 13:30786921-30786943 CAGCTTGGTTGCAGGGCAACTGG - Intergenic
1107078485 13:36348505-36348527 CATCAAGGATTCAGGACAACAGG + Intronic
1107740568 13:43445779-43445801 CTCCTGGGATGCAGGTCATCAGG + Intronic
1110640517 13:77818797-77818819 CTGGAAGGATGCAGGAGAATAGG + Intergenic
1111166974 13:84472073-84472095 CGACGAGGATGCAGAACAACAGG + Intergenic
1114724151 14:24916685-24916707 CTCCTAGGATCTAGGACACCTGG + Intronic
1114954842 14:27805114-27805136 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1115387355 14:32813312-32813334 CTTCTAGGTTGCAGAACACCTGG - Intronic
1115932162 14:38508956-38508978 CAGCTAGGATGCAGGGCACCAGG + Intergenic
1117304312 14:54459121-54459143 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1117731901 14:58731164-58731186 TAGCTAGGATGAAGAACAACCGG - Intergenic
1119151293 14:72361957-72361979 CTGCAGGGAAGCAGGACCACTGG + Intronic
1120844480 14:89113996-89114018 CAGCTAGGATCCAGGAGAAGCGG - Intergenic
1121025535 14:90613517-90613539 CTCCTAGAATACAGGACAAGGGG + Intronic
1121486902 14:94323305-94323327 ATGCTAGGGTCCAGGACAGCAGG - Exonic
1122395274 14:101423578-101423600 TTGGTAGGGTGCAGGGCAACTGG + Intergenic
1122867407 14:104613462-104613484 CTGGAAGGATCCAGGACAGCTGG + Intergenic
1127212140 15:56784289-56784311 CTGCTGGGATGCAGTCCAATAGG - Intronic
1131760811 15:95620597-95620619 CAGCTAGGGTGAGGGACAACTGG - Intergenic
1132376603 15:101332283-101332305 CTGCTGGGATGGAGGTCAGCCGG + Intronic
1138050608 16:53773251-53773273 ATGCTTGGAAGCAGGAAAACAGG - Intronic
1139137298 16:64220356-64220378 CTGCTAAGATGCACCACAAATGG + Intergenic
1139189865 16:64849729-64849751 TAGCAAGGATGCAGAACAACAGG + Intergenic
1140201050 16:72895011-72895033 GTGCTGGGATGCATGCCAACCGG + Intronic
1140586453 16:76298702-76298724 CTGCAGGGATGCTGGCCAACTGG + Intronic
1141766763 16:86064143-86064165 CTGCAAGGCTGCAGGACAGCTGG - Intergenic
1143473405 17:7190310-7190332 CTGCAGGGATGCAGGGCCACAGG - Exonic
1148693087 17:49544325-49544347 CTGCCAGGATGCAGGAGGGCAGG + Intergenic
1148796240 17:50198291-50198313 CAGAAAGGATGCAGGACGACTGG - Intronic
1151288620 17:73132178-73132200 GCGCTAGGATGCAGAACAGCAGG - Intergenic
1151712450 17:75814536-75814558 CTGATAGGAGACAGGGCAACAGG - Intronic
1152163660 17:78686506-78686528 ATGCTAGAATGCAGAACACCTGG - Intronic
1152635099 17:81427615-81427637 CTCCTAGGCTGCAGGGCAAGGGG - Intronic
1153136884 18:1927409-1927431 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1154040911 18:10855114-10855136 CCGCTGGGATGCAGGAGGACAGG - Intronic
1159686756 18:71431346-71431368 CTGGCAGGATGGAGAACAACTGG - Intergenic
1160569327 18:79806091-79806113 CTGCCAGGGTGCAGGACAGCAGG + Intergenic
1162481126 19:10927770-10927792 CTGCAAGGAGGCAGGACACAGGG + Intronic
1163687040 19:18717602-18717624 CAGCTTGGATGCAGGACCCCTGG + Intronic
1164926041 19:32130719-32130741 CTGCCAGCAGCCAGGACAACTGG + Intergenic
1165481141 19:36064992-36065014 CTGGTAGGAAGCAGGGCAAAGGG + Intronic
1166895592 19:46020061-46020083 CTGCAAGGATTCAGTAAAACAGG - Intronic
1167103290 19:47417021-47417043 CTGCCAAGATGCAGAACAGCTGG + Intronic
925627311 2:5854049-5854071 CTGCCAGGATGAAGGACACAGGG - Intergenic
926497757 2:13612786-13612808 TAGATAGGATGCAGGAAAACAGG + Intergenic
927942502 2:27113885-27113907 CTGCTAGGACCCAGGCCGACAGG + Intronic
928011885 2:27616815-27616837 CTGGTAGGTTGTAGGACACCTGG - Intronic
928551246 2:32373075-32373097 TGGCAAGGATGCAGAACAACTGG - Intronic
930602124 2:53455425-53455447 CTGCTTGGATGCACCACAGCAGG + Intergenic
931022974 2:58070945-58070967 TGGCAAGGATGCAGCACAACAGG - Intronic
932935706 2:76098660-76098682 CAGCTGGGATGCAGGGCACCAGG + Intergenic
933423052 2:82076390-82076412 CTTCTAGGATGCAGGAAAACTGG + Intergenic
934482479 2:94664179-94664201 CAGCTGGGATGCAGGACACCAGG + Intergenic
937148484 2:119668684-119668706 CTGCTAGTAAGCTGGACATCTGG + Intergenic
937767593 2:125680008-125680030 CTGGTAGTATGGAGAACAACTGG + Intergenic
944342004 2:198612201-198612223 CTGCTGGGATGAAGGACTAAGGG - Intergenic
946046133 2:216822595-216822617 CTGTTTGGATATAGGACAACAGG + Intergenic
946397566 2:219451045-219451067 TTTCTAGGATGCAGGCCACCAGG + Intronic
948686562 2:239674230-239674252 CTGCCAGGCTGCGGGAAAACAGG + Intergenic
1169905364 20:10597825-10597847 TGGCAAGAATGCAGGACAACTGG - Intronic
1170896514 20:20419925-20419947 CTGCTAGAATGCAGGATTGCTGG - Intronic
1176053771 20:63134355-63134377 ATGCCAGGATGCATGACCACTGG + Intergenic
1179545908 21:42112050-42112072 CTGCTAGGAGGCAGGACAGCGGG - Intronic
1182356488 22:29724522-29724544 CTGCCAGGATGTAGGAGAGCTGG + Intronic
1184418462 22:44365384-44365406 CTGCTGGGAAGCAGCACCACAGG - Intergenic
1184430625 22:44439896-44439918 CCGCTAGGATCCAGCACACCTGG + Intergenic
1184706432 22:46216758-46216780 CTGGCAGCATGCAGGACAACAGG - Intronic
956202767 3:66723396-66723418 CTGCTGGGATGCATGATCACTGG + Intergenic
960058156 3:113291097-113291119 CTGAGAGGATGCAGGAGAAAAGG - Exonic
962534636 3:136316787-136316809 CTCCAAGGAAGCAGGACAACAGG - Intronic
965142377 3:164855599-164855621 CTGCCAGGAATCAGGACAATGGG - Intergenic
966707722 3:182934754-182934776 CTCCTAGTAGGCAGGACTACAGG - Intergenic
967596893 3:191336293-191336315 CAGCAAGGATGCAGAACAACTGG - Intronic
969153955 4:5193584-5193606 CTTCCAGGATGCAGCACAGCCGG - Intronic
970400933 4:15717120-15717142 CATCTAGGCTGCAGGACACCTGG - Intronic
971199017 4:24495104-24495126 CTGCTAGGGTGCAGCAGAATAGG - Intergenic
974097266 4:57377104-57377126 CTGCTAGAAAGCAGTAAAACAGG - Intergenic
974679890 4:65147081-65147103 CAGCTGGGATGCAGGACATCAGG + Intergenic
975514979 4:75237132-75237154 CTGATGGGATGCAGCACAAAAGG + Intergenic
979814448 4:125082764-125082786 GTGCTAGGTTGCAGGGCAAAAGG + Intergenic
980299122 4:130965178-130965200 CAACTAGGATGCAGGGCACCAGG - Intergenic
980663008 4:135891245-135891267 GTGCTAGAATACAGAACAACTGG - Intergenic
982207610 4:153008726-153008748 CTGGTAGGAGCCAGGAGAACAGG - Intergenic
982344752 4:154345044-154345066 CTGGTAGGAAACTGGACAACAGG - Intronic
983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG + Intergenic
986111289 5:4721096-4721118 CAGCATGGAAGCAGGACAACCGG - Intergenic
986911635 5:12565055-12565077 CAGCTGGGATGCAGGGCACCAGG + Intergenic
987550115 5:19368710-19368732 ATGCTAGGTTGCAGGGCAAAAGG + Intergenic
987709068 5:21486134-21486156 CAGCTGGGATGCAGGGCACCAGG + Intergenic
987909982 5:24129224-24129246 CTGCCAGGATGCAGAATAGCTGG + Intronic
988371416 5:30373084-30373106 CTTCTAGGAAACAGGACAAAAGG + Intergenic
988750544 5:34188019-34188041 CAGCTGGGATGCAGGGCACCAGG - Intergenic
994431748 5:99674230-99674252 CTGGTTGGAAGCAGCACAACAGG - Intergenic
994515175 5:100762201-100762223 CTGTTTGGAAGCAGGACAGCTGG - Intergenic
994592342 5:101789078-101789100 CTGCTAGGACGCAGGGTACCAGG - Intergenic
997741119 5:136255831-136255853 CTGCTAGGAAGCAGGAGATCTGG + Intronic
999040799 5:148409411-148409433 TTGCTAGTATGCAGCTCAACTGG - Intronic
999115131 5:149156079-149156101 CAGCTTGGCTGCAGAACAACTGG - Intronic
999260005 5:150232504-150232526 CTGCCAGGAGCCAGGACACCTGG - Intronic
999552034 5:152699759-152699781 TGGCAAGGATTCAGGACAACAGG - Intergenic
1000642732 5:163722057-163722079 CTGCTTGGATGCAGGAGACAAGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003300358 6:4875160-4875182 CTGCTAGGATGCAGGACAACAGG - Intronic
1003568124 6:7237745-7237767 TTGCAGGGATGCAGGAAAACGGG - Intronic
1004916546 6:20338142-20338164 TTGCTAGGAATCAGGTCAACAGG + Intergenic
1010009003 6:71028457-71028479 CAGCTAGGAGGCAGGTCACCTGG - Intergenic
1010722969 6:79304519-79304541 CTGCTTGGATGCAGAGCATCTGG - Intergenic
1011708547 6:90027690-90027712 CAGCTAGGAAGCAGGAGAGCAGG - Intronic
1012196024 6:96342190-96342212 CAGCTAGGATGTAGGGCACCAGG + Intergenic
1017325467 6:153136599-153136621 CTTCTAGGCTGCATCACAACAGG - Intergenic
1018762898 6:166906494-166906516 CTGCGGGGCTGCAGGACCACGGG - Intronic
1019315250 7:381158-381180 CTGATGGGAGGCAGGACAAAGGG - Intergenic
1019324900 7:433256-433278 CTGCTAGGATGCAGCCCGCCCGG + Intergenic
1020777495 7:12473197-12473219 GTGCCTGGATGCAGGACAGCAGG - Intergenic
1022415429 7:30172937-30172959 CTGCCAGGAGGAAGGACAAGTGG - Intergenic
1023943350 7:44784469-44784491 CTGCTAGGGTGCAGGTGCACAGG - Intergenic
1028901110 7:96101408-96101430 TTGCTAGGAGGGAGGACACCAGG + Intronic
1029903341 7:104065906-104065928 CTGCTTGGAAACAGGAGAACAGG + Intergenic
1032932032 7:136683729-136683751 ATGCTAGGTTGCAGGAAAACAGG + Intergenic
1037154675 8:15684998-15685020 CTGCTAGGCTGCAAGAGAGCAGG - Intronic
1041354262 8:56983535-56983557 CTGTTATGATGGAGGGCAACTGG - Intronic
1049388857 8:142357960-142357982 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388872 8:142358020-142358042 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388887 8:142358080-142358102 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388901 8:142358140-142358162 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388916 8:142358200-142358222 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388931 8:142358260-142358282 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1052020588 9:23521235-23521257 CAGCTAGGATGGAGGGCACCAGG + Intergenic
1053675364 9:40420556-40420578 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1053925153 9:43046893-43046915 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054288636 9:63259082-63259104 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054386462 9:64560619-64560641 CAGCTGGGATGCAGGGCACCAGG - Intergenic
1054509258 9:65955736-65955758 CAGCTGGGATGCAGGGCACCAGG + Intergenic
1057444917 9:95107034-95107056 GTACTAGGATGCTGGACCACAGG + Intronic
1060198580 9:121638890-121638912 CTCCTAGGATACAGGACATGGGG - Intronic
1061940519 9:133881389-133881411 CTGATGGGATGCAGGAGAGCTGG - Intronic
1186819334 X:13270897-13270919 CTGTTTGGATGAAGTACAACTGG - Intergenic
1189164276 X:38844950-38844972 CTGCTGGAATGAAGGACAATGGG - Intergenic
1189741829 X:44125639-44125661 TGGCTAGGATGCAGAGCAACTGG - Intergenic
1199715634 X:150505695-150505717 CTGCAGGGAGGCAGGACCACTGG - Intronic
1200052041 X:153438546-153438568 CTGCCAGGCTGATGGACAACTGG + Intergenic