ID: 1003302999

View in Genome Browser
Species Human (GRCh38)
Location 6:4901935-4901957
Sequence GTGGCAGCCCAGAGCTGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003302999_1003303007 8 Left 1003302999 6:4901935-4901957 CCCCCGCAGCTCTGGGCTGCCAC 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1003303007 6:4901966-4901988 CTCAGCTGACCAGACAGAAAAGG 0: 1
1: 0
2: 2
3: 18
4: 235
1003302999_1003303008 9 Left 1003302999 6:4901935-4901957 CCCCCGCAGCTCTGGGCTGCCAC 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1003303008 6:4901967-4901989 TCAGCTGACCAGACAGAAAAGGG No data
1003302999_1003303009 10 Left 1003302999 6:4901935-4901957 CCCCCGCAGCTCTGGGCTGCCAC 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1003303009 6:4901968-4901990 CAGCTGACCAGACAGAAAAGGGG 0: 1
1: 0
2: 3
3: 30
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003302999 Original CRISPR GTGGCAGCCCAGAGCTGCGG GGG (reversed) Intronic
900081981 1:865292-865314 GAGGCTCACCAGAGCTGCGGTGG - Intergenic
900659240 1:3774600-3774622 GTGGCTGCCCAGAGCAGGAGGGG - Intronic
900825814 1:4925822-4925844 GTGGCAGCACAGGGCAGCTGGGG - Intergenic
900958538 1:5904445-5904467 GAGGCAGCTGAGAGCTGCTGGGG + Intronic
900995848 1:6123284-6123306 GTGGCTGCCCAGGCCTGGGGTGG + Intronic
901416850 1:9122167-9122189 GAGGGAGGCCAGAGCTGCTGTGG - Intronic
901475961 1:9489493-9489515 GTGGTTGCCCAGGGCTGGGGAGG - Intergenic
901747582 1:11384736-11384758 GTGGCAGCCATGAGCTGGGAAGG + Intergenic
903286551 1:22280878-22280900 GTGGCTGCCAGGAGCTGGGGAGG + Intergenic
903353526 1:22732284-22732306 GTGGGAGCCAAGAGCTGCGGGGG + Intronic
903461248 1:23522319-23522341 CTGGCAGCCCTAAGCTGTGGTGG - Intronic
903603042 1:24556087-24556109 GTGGCAGCGCCGGGCGGCGGCGG + Intergenic
905928745 1:41771436-41771458 GAGGCAGGCCTGAGCTCCGGAGG - Intronic
907386818 1:54131170-54131192 GTGGGAGAGCAGAACTGCGGAGG - Intergenic
908131776 1:61082122-61082144 GTGGCAGCCTATAGCTGCCCGGG + Intronic
909407642 1:75310234-75310256 TTGGCAGTCCTGAGCTGGGGTGG + Intronic
909443708 1:75724822-75724844 GAGGGAGCCCAGCGGTGCGGTGG + Intronic
910569645 1:88684818-88684840 GTGGCAGGCCAGGGCTTTGGCGG - Intronic
910616044 1:89199322-89199344 GTTGTTGCCCAGAGGTGCGGTGG + Intergenic
914242040 1:145858839-145858861 GTGGCAGGCACGAGCTGCTGAGG - Intronic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
917448619 1:175127873-175127895 GTGGCAGCCCAGAATCGCAGTGG - Intronic
918577464 1:186079958-186079980 GTGGAAGCAAAGAGCTGAGGTGG + Intronic
919478435 1:198056642-198056664 GTGGAAGCCCATAGCAGCAGTGG + Intergenic
921080049 1:211732039-211732061 CTGGCAGCCCAGGGCTCTGGCGG - Intergenic
922450418 1:225732883-225732905 GTTGCAGAGCAGGGCTGCGGGGG + Intergenic
922699062 1:227747592-227747614 GTGTGAGCCCAGAGCCGCAGGGG + Intronic
922958629 1:229626025-229626047 GCGGCCGCCCAGAGCGGCGGCGG - Exonic
924205517 1:241707691-241707713 ATGGCGTCCCAGAGCTGTGGGGG - Intronic
1063358140 10:5421785-5421807 GTGGCTGCCTAGGGCTGGGGTGG - Intronic
1065811591 10:29448355-29448377 GAGGCAGCCCCGTGCTGGGGAGG + Intergenic
1069609716 10:69764814-69764836 GTGGCAGCCCAGAAGTGCCAGGG - Intergenic
1074962903 10:118463965-118463987 GTGGCTGTCCACAGCTGAGGAGG + Intergenic
1075782371 10:125025872-125025894 GTGTCAGGCCAGATCTGCTGGGG - Intronic
1075879755 10:125840639-125840661 GTGGCACACCAGAGCTCCGTGGG + Intronic
1076314045 10:129528351-129528373 GTGGCTGTGGAGAGCTGCGGTGG + Intronic
1076314113 10:129528669-129528691 GTGGCCGTGGAGAGCTGCGGTGG + Intronic
1076353528 10:129834972-129834994 GTGTCACCCCAGTGCTGCTGTGG + Intergenic
1076527558 10:131121860-131121882 GAGGCAGGCCAGGGCTGAGGGGG - Intronic
1076878997 10:133230890-133230912 GGGGCTGCCGAGGGCTGCGGGGG + Intronic
1077109347 11:855233-855255 TTGGCAGCCCAGGGCTGCAGGGG + Intronic
1077281207 11:1747072-1747094 CTCGCAGCCCTGAGCTGGGGAGG + Intronic
1077523011 11:3047461-3047483 GTGGAACCCCAGAGCCGCAGCGG + Intronic
1077538614 11:3136037-3136059 GTGCCAGCCCAGAGCAGATGGGG + Intronic
1078101025 11:8330394-8330416 GTGGCAACCCAGAAGTGAGGAGG + Intergenic
1078870856 11:15343252-15343274 GTCCCAGCCTAGGGCTGCGGAGG + Intergenic
1080428786 11:32179585-32179607 GAGGCAGGCCAGAGTTGTGGGGG - Intergenic
1080431075 11:32200528-32200550 GTGGCGGCACGGAGCTGCCGAGG + Intergenic
1081249033 11:40806417-40806439 ATGGCAGCTCAGAGCTGCTGGGG + Intronic
1081792665 11:45799350-45799372 TAGGCAGCCCAGAGCTGAGAGGG + Intergenic
1083232676 11:61333096-61333118 GTTGCAGGCCAGAGCGGCCGGGG + Exonic
1083628462 11:64083935-64083957 GCGGCAGCCCGGCGCTGCTGTGG + Intronic
1083941228 11:65896950-65896972 GTGGCAGTCAGGAGCTGCAGTGG - Exonic
1091298572 11:134490219-134490241 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298583 11:134490260-134490282 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298594 11:134490301-134490323 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298605 11:134490342-134490364 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1094006276 12:25755335-25755357 GCAGCAGCCCAGAGATGCAGTGG - Intergenic
1096500623 12:52062124-52062146 GTGGCACCTCAGGGCTGGGGAGG - Intergenic
1096772087 12:53941731-53941753 GTGGGAGCACATAGCTGCTGAGG - Intronic
1101329406 12:103745302-103745324 CTGGCAGCCCAGGGCTGCAGTGG + Intronic
1101730465 12:107422901-107422923 GTGTCAGCTTAGAGCTGCTGGGG - Intronic
1101881732 12:108630319-108630341 GTGGCCGCCCTGAGCTGCTCAGG + Intronic
1102349363 12:112180773-112180795 GGGGCAGCTGAGAGCTGAGGGGG + Intronic
1104421581 12:128640454-128640476 GTGGCCGCCCAGGGCTGGGAGGG + Intronic
1104784988 12:131443603-131443625 GAGGAAGCCCAGAGCTGCATGGG + Intergenic
1105529825 13:21209123-21209145 GGGGCTGCCCAGGGCTGTGGGGG + Intergenic
1106034671 13:26032968-26032990 GTGGCTGCCCAGCGCTGTGAAGG + Intergenic
1106581039 13:31018690-31018712 CTTCCAGCCCAGAGCTGAGGAGG - Intergenic
1107624838 13:42272036-42272058 GTTGCGGGCCGGAGCTGCGGCGG + Intergenic
1109585395 13:64395627-64395649 ATTGCAGCCCAGAGCAGTGGAGG + Intergenic
1113485917 13:110652292-110652314 GTGGGAGCACAGAGCTGCCAGGG + Intronic
1117327850 14:54685279-54685301 GTGGCTGCCAGGAGCTGGGGGGG - Intronic
1118203317 14:63697963-63697985 GTTGCAGGCCAGAGCTAAGGGGG + Intronic
1119327814 14:73771960-73771982 GAGGCAGCCCAGAGGTGAGTGGG + Intronic
1121604743 14:95232221-95232243 GTGGCAGCTCACAGCCGAGGAGG - Intronic
1122832164 14:104403804-104403826 GTGGCAGCTCAGAACTTCCGTGG + Intergenic
1123813698 15:23955137-23955159 GTGGGCGCCAAGAGCTGGGGGGG + Intergenic
1123936859 15:25198258-25198280 GTGGCACCCCAGAGCCCCTGTGG - Intergenic
1124527580 15:30471280-30471302 GCGGCGGCCCACGGCTGCGGCGG + Intergenic
1124771079 15:32536422-32536444 GCGGCGGCCCACGGCTGCGGCGG - Intergenic
1125685140 15:41559373-41559395 GTGCCAGCCCCTACCTGCGGCGG - Exonic
1125815085 15:42576982-42577004 GTGGTAGCTCAGGGCTGGGGGGG + Intronic
1127752582 15:62060416-62060438 GTCGCAGCCCTCAGCTGCGCCGG - Exonic
1128345980 15:66852642-66852664 CTGGCCTCCCAGAGCTGCTGGGG - Intergenic
1128766594 15:70254836-70254858 GTGGGAGCCAAGGGCTGCAGGGG - Intergenic
1128775703 15:70318517-70318539 CTGGAAGGCCAGAGCTGTGGTGG - Intergenic
1129457378 15:75683094-75683116 GTGGCAGCCCAGGGCCGGGGAGG - Intronic
1129458655 15:75689048-75689070 GTCGCAACCCTGTGCTGCGGTGG + Exonic
1129725138 15:77897824-77897846 GGTGCAGCCCTGTGCTGCGGTGG - Intergenic
1130273195 15:82463030-82463052 GATGCAGCCCTGTGCTGCGGTGG - Intergenic
1130274448 15:82469199-82469221 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130465547 15:84190401-84190423 GATGCAGCCCTGTGCTGCGGTGG - Intergenic
1130466795 15:84196573-84196595 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130483895 15:84387033-84387055 GGGGGAGCCCAGAGGTGCTGGGG - Intergenic
1130487145 15:84404419-84404441 GATGCAGCCCTGTGCTGCGGTGG + Intergenic
1130497469 15:84476963-84476985 GTGGCAGCCCAGGGCCGGGGAGG - Intergenic
1130498718 15:84483135-84483157 GATGCAGCCCTGTGCTGCGGTGG + Intergenic
1130587836 15:85194996-85195018 GATGCAGCCCTGTGCTGCGGTGG - Intergenic
1130589090 15:85201166-85201188 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1132544507 16:527201-527223 CTGGCGGCCAAGAGCGGCGGTGG - Intergenic
1132576315 16:665984-666006 GTGGCCGCCCTGAGCAGCAGCGG + Exonic
1132604271 16:787212-787234 GGGGCAGCCCAGTGCTGCCGGGG + Intronic
1133849136 16:9485570-9485592 GTGGGAGCACAGAGCTGCTGGGG + Intergenic
1134240604 16:12503175-12503197 GAGGCAGCTCAGAGCAGCAGTGG - Intronic
1136399117 16:30008280-30008302 GGGGCAGACCAAAGCTGCAGAGG + Intronic
1136428368 16:30183790-30183812 GTGGGAGCCGCGGGCTGCGGGGG + Intronic
1136922804 16:34345896-34345918 GTGGGCTCCCAGAGCTGGGGAGG - Intergenic
1136981769 16:35065910-35065932 GTGGGCTCCCAGAGCTGGGGAGG + Intergenic
1137576706 16:49604801-49604823 GTGGCAGCCCAGGAATGGGGTGG - Intronic
1138605175 16:58083973-58083995 CTGGCAGCTCACAGCTGCAGTGG + Intergenic
1139448723 16:67014230-67014252 GCGCCAGCCCAGAGCCGGGGCGG + Intergenic
1139671651 16:68496465-68496487 GTGGCTGCCTAGGGCTGGGGAGG + Intergenic
1140348657 16:74240394-74240416 GTGGCAGCACACAGCAGCAGTGG + Intergenic
1141461154 16:84179538-84179560 TGGGCAGCACAGAGCTGCGGAGG - Exonic
1141717131 16:85733375-85733397 GTGGCTGCCAAGGGCTGGGGAGG + Intronic
1142324745 16:89407393-89407415 GAGGCAGCCCAGTGTTGCTGGGG - Intronic
1146759120 17:35460677-35460699 GTGGCAGCCCAGCGGGGCGGGGG - Intergenic
1146905790 17:36617138-36617160 GTGACAGCTCAGAGCTACTGTGG + Intergenic
1147646966 17:42039858-42039880 GCCGCAGCCGGGAGCTGCGGTGG - Intronic
1148185458 17:45640221-45640243 GTGGTTGCCCAGTGCTGCGGAGG - Intergenic
1148190469 17:45675207-45675229 GTGGCCGCCCACGGCTGGGGAGG - Intergenic
1148794605 17:50191013-50191035 GAGGCAGGGCAGAGCTGCAGAGG - Intronic
1148798962 17:50211122-50211144 GGGGCAGGCCAGGGCTGCTGGGG - Intergenic
1149526511 17:57360074-57360096 GTGGCTGCCCAGAGCAGGCGAGG + Intronic
1149656617 17:58312513-58312535 GAGCCAGCCCAGACCTGAGGAGG - Exonic
1150125041 17:62629831-62629853 GTGGCAGGCCAGTGCTGCTGGGG + Intronic
1151427435 17:74040260-74040282 ATGGCAGCCCAGAAATGCAGGGG - Intergenic
1151892403 17:76958512-76958534 GAAGCAGCCCAGAGCTGGGTGGG + Intergenic
1152024543 17:77800268-77800290 GTGGTTGCCTAGGGCTGCGGAGG + Intergenic
1152630659 17:81409430-81409452 GAGGCAGCCCACAGCTGTGAAGG + Intronic
1152803754 17:82344827-82344849 GTGGCAGCCCAGGGCGGAGTGGG - Intergenic
1153626023 18:7023163-7023185 GTGACAGCCAAGAACTGCCGCGG - Exonic
1153952668 18:10070301-10070323 GTGGAAGCCAAGAGCTCTGGTGG + Intergenic
1154330087 18:13422224-13422246 GTGGGAGGTCAGAGCTGCAGGGG + Intronic
1158853398 18:61518025-61518047 GTGGCTTTGCAGAGCTGCGGTGG - Intronic
1159902777 18:74063622-74063644 GTGGCATCTCAGAGCAGTGGGGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160427464 18:78788030-78788052 GTGGCTTCCCAGAGCCCCGGAGG + Intergenic
1160511579 18:79456182-79456204 GTGACAGCCCAAAGCCACGGTGG - Intronic
1161120682 19:2524172-2524194 GTGGCTGCCCAGGGCAGCAGGGG - Intronic
1161575726 19:5053251-5053273 TTGGCAGCTCAGAGCCGCTGCGG + Intronic
1161960345 19:7519722-7519744 GGCTCAGCCCGGAGCTGCGGCGG - Exonic
1162796890 19:13091733-13091755 GTGCCAGCCCAGAGCTGGGAGGG - Intronic
1163033454 19:14558919-14558941 GGGGAAGCCCAGGGCTGCAGAGG - Intronic
1163634047 19:18430286-18430308 GTGGCAGCCCAGACCTGGCCGGG - Intronic
1163774149 19:19208207-19208229 CTGGCAGACCAGAGCAGAGGTGG - Intergenic
1164503516 19:28839403-28839425 CTGAGAGCCCAGAGCTGCAGTGG - Intergenic
1164673541 19:30087353-30087375 GTGGCATCACAGGGCTGTGGGGG - Intergenic
1165150909 19:33759598-33759620 GTGGCTGGTCAGAGGTGCGGGGG - Intronic
1165815139 19:38637210-38637232 GTGGCAGCCCAGCCCTGTGGTGG + Intergenic
1167579502 19:50333254-50333276 CTTGCTGCCCAGAGCTGCCGGGG - Intronic
1167777707 19:51571796-51571818 TTGGCAGCCAAGAGCTTCAGAGG + Intronic
1168152206 19:54455282-54455304 GTGTCAGCTCAGAGTGGCGGTGG + Intronic
924959777 2:23894-23916 GTGGGAGCCCGCAGCTGCAGTGG - Intergenic
925090104 2:1148418-1148440 GTGGGAACCCAGAGCTGGGGAGG + Intronic
926094635 2:10073219-10073241 CTGGCAGCCCACAGCCGGGGGGG - Intronic
926104053 2:10139237-10139259 GTGGCTACCCAGGGCTGAGGCGG - Intergenic
927708517 2:25311416-25311438 GAGCCAGCCCAGAGGTGCCGGGG + Intronic
929588894 2:43132758-43132780 GTGGCTGCCCAGGTCTGCAGTGG + Intergenic
930090165 2:47525977-47525999 GTGTCAGCCCAGAGCTAGAGGGG + Intronic
932435571 2:71700917-71700939 GGGACAGCCCAGACCAGCGGAGG - Intergenic
933986140 2:87593902-87593924 CAGGCAGCCCAGAGCTGCCCAGG + Intergenic
934490708 2:94760565-94760587 GGGGCAATCCAGAGCTGTGGGGG - Intergenic
934652767 2:96101809-96101831 GGGGCAGCCAAGAGCTGGTGGGG + Intergenic
934946834 2:98548383-98548405 CTGGCTGTGCAGAGCTGCGGTGG - Intronic
935675972 2:105595285-105595307 GTGGCAGCTCACACCTGCGAGGG - Intergenic
936142029 2:109948733-109948755 GCAGCAGCCCAGAGCTGAAGGGG - Intergenic
936178719 2:110246693-110246715 GCAGCAGCCCAGAGCTGAAGGGG - Intergenic
936202659 2:110422739-110422761 GCAGCAGCCCAGAGCTGAAGGGG + Intronic
936307696 2:111356901-111356923 CAGGCAGCCCAGAGCTGCCCAGG - Intergenic
936865371 2:117071664-117071686 GTGGCAGCCCACCGCGGTGGGGG + Intergenic
937115841 2:119404451-119404473 GAGGCAGCACAGAGCTATGGGGG - Intergenic
937261043 2:120587025-120587047 GTGACGGCGCAGAGCTGCGCGGG + Intergenic
937917243 2:127105365-127105387 ATGGCAGCCCGGAGCAGGGGTGG + Intronic
940774969 2:157875955-157875977 GGGCCGGCCCAGAGCGGCGGCGG + Intergenic
942325499 2:174772893-174772915 GTTGGACCCCAGAGCTGCCGTGG - Intergenic
943011196 2:182451775-182451797 GGGGCAGCTCAGAGCTGCATGGG - Intronic
946292752 2:218757721-218757743 GGGGCAGTCCAGTGCTGCTGAGG + Intergenic
946369920 2:219274526-219274548 GTGGCAACCCAGACCTCCTGAGG + Intronic
947582155 2:231326995-231327017 GTGGCAGCCAAGTGCTGGAGTGG - Intronic
948237582 2:236402107-236402129 CTGCCAGCCCTGAGCTGGGGAGG - Intronic
948360134 2:237414076-237414098 GTGGAGACTCAGAGCTGCGGAGG + Exonic
1169116965 20:3072162-3072184 CTGGCAGCGCAGCGCTTCGGCGG - Exonic
1169219874 20:3815888-3815910 GGGGCAGCTCAGAGGTGAGGGGG - Intergenic
1169327026 20:4684732-4684754 GTGGGAGGACAGAGCTGGGGTGG - Intergenic
1170627917 20:18043535-18043557 GTGGCAGCCCTGAGTTGGGATGG - Intronic
1172107169 20:32523718-32523740 CAGGCAGCCCAGGGCAGCGGAGG - Intronic
1172284556 20:33731849-33731871 AGGGCAGCCCAGAGATGCTGGGG + Exonic
1172398178 20:34624860-34624882 GTGGCAGCCCAGGGTTGCCTGGG - Intronic
1172481789 20:35275848-35275870 GTAGCAGCCCCAAGCTGAGGGGG + Exonic
1173571963 20:44082893-44082915 GTGGCTGCCTAGAGCAGTGGGGG - Intergenic
1174111681 20:48201823-48201845 GGGGGAGCCCAGAGCTGCCTGGG - Intergenic
1174169459 20:48607009-48607031 GGGGGAGCCCAGAGCTGCCTGGG + Intergenic
1174280648 20:49436656-49436678 GTGGCTGCCCAGGGCTGGGATGG + Intronic
1175106895 20:56621864-56621886 GTGGCAACCCAGAGATCCAGAGG - Intergenic
1175273810 20:57753902-57753924 GTGGGAGCCCTCAGCTGCTGCGG + Intergenic
1175429541 20:58891716-58891738 GAGGCAGCCCATGGCGGCGGCGG - Intronic
1176177382 20:63735150-63735172 GTGTCGGCCCAAACCTGCGGAGG - Exonic
1178627629 21:34231511-34231533 GCAGCAGCCCAGAGCTGGAGAGG - Intergenic
1179728871 21:43356185-43356207 GTGGAAGGACAGAGCTGCTGGGG + Intergenic
1179933901 21:44590727-44590749 GGGGCAGCCATGAGCTGGGGAGG + Intronic
1180705717 22:17808621-17808643 ATGGCAGCCCAGAGGGGCTGTGG + Intronic
1181447852 22:22992412-22992434 GTGGAAGCCCAAGGCTGTGGAGG + Intergenic
1181836868 22:25617603-25617625 GTGGCTGCCCAGGGCTGGGGTGG - Intronic
1182043775 22:27258888-27258910 GTGGCAGAGCAGAGATGCGTGGG + Intergenic
1182355060 22:29719242-29719264 TCGGCACCCCAGAGCTGGGGTGG - Intergenic
1183062120 22:35342626-35342648 CTGGCATCCCAGAGCTGTTGTGG + Intronic
1183735364 22:39642075-39642097 GAGGCAGCGCAGGGCAGCGGAGG - Intronic
1183987219 22:41576313-41576335 CTGGGAGCCCAGAGCTGCTGAGG + Exonic
1184031375 22:41896851-41896873 GTGACAGCCCAGAGACACGGAGG + Intronic
1184437810 22:44490245-44490267 CTGGCTGCCCAGACCTGCAGCGG + Intergenic
1184570136 22:45317799-45317821 GTGGCAGGCCAGAGCTCTGCAGG + Intronic
1184723024 22:46326535-46326557 GTGGAAGGCCAGAGCAGCGCCGG - Exonic
1185224088 22:49643275-49643297 GTGGGTGCCCAGTGCTGCCGGGG - Intronic
950007545 3:9701186-9701208 GTGGAAGCAGAGAGCTGCTGGGG + Intronic
951317347 3:21203706-21203728 ACGGCAGCCCATAGCTGCAGAGG + Intergenic
953640564 3:44703311-44703333 GTGGCATTCCAGAGAGGCGGGGG - Intergenic
955137951 3:56238529-56238551 GTGGCAGCACTGATCTGCTGGGG - Intronic
955827285 3:62961979-62962001 CAGGTAGCCCAGAGCTGTGGTGG + Intergenic
956527345 3:70179470-70179492 GTGGGAGCCAAGAGCAGCTGAGG - Intergenic
961074341 3:123967709-123967731 GGTGCAGCCCAGTGCTGTGGGGG + Intergenic
961639782 3:128357918-128357940 GTGGCGCCACAGAGCTGCTGTGG + Intronic
963026546 3:140924745-140924767 AGGTCAGCCCAGAGCTGCGGAGG + Intergenic
963091500 3:141487292-141487314 GTGGCGGCGCCGAGCTGCGCTGG + Intronic
963374317 3:144444288-144444310 GTGGTAGCCCAGAACAGCAGAGG - Intergenic
967210931 3:187167971-187167993 TTGGCTGCCCAGTGCTCCGGAGG - Intronic
967527696 3:190513952-190513974 CTGGAAGCCCAGAGCGCCGGTGG + Intergenic
968085839 3:195873547-195873569 GTGACAGCCCAGAGCTGCTAGGG + Intronic
968375415 4:36330-36352 GTGGGAGCCCACAGCTGCAGTGG - Intergenic
968610274 4:1553909-1553931 ATGGCGTCCCACAGCTGCGGAGG - Intergenic
969045566 4:4334131-4334153 GTGGCAGCACAGTGTTGAGGAGG - Intergenic
969238852 4:5886998-5887020 GACTCAGCCCAGAGCTGGGGCGG + Intronic
969626203 4:8306902-8306924 GCTGCATCCCAGAGCTGCGTGGG - Exonic
971254763 4:25004193-25004215 GTGGTAGCCCAGCTCTTCGGTGG - Exonic
971453695 4:26823557-26823579 GAGAGAGCCCAGAGTTGCGGGGG + Intergenic
972879905 4:43410344-43410366 GCAGCAGCACAGAGCTGCAGCGG + Intergenic
974870761 4:67638164-67638186 GTGGCAGGTCAGAGCTGCTGCGG + Intronic
976113160 4:81698773-81698795 GTGGCAGCTCACAGCTGCTGAGG + Intronic
976390084 4:84497948-84497970 GTGGCGGCCGAGAGCTGCTGCGG + Exonic
981748430 4:148072152-148072174 GGTGCAGCCCAGAGCCTCGGAGG - Exonic
985808726 5:2067970-2067992 GTGACAGCCCAGGGGTGGGGAGG + Intergenic
986079900 5:4379423-4379445 GAGGCAACCCAGCGGTGCGGGGG - Intergenic
986188133 5:5464471-5464493 GTGGCCGCACAGAACTGCAGAGG - Exonic
987119997 5:14758250-14758272 GAGGTTGCCCAGAGCTGGGGAGG + Intronic
988494259 5:31731485-31731507 GTGGTTGCCAAGAGCTGCAGAGG - Intronic
988719232 5:33859414-33859436 GTGGCATTGCTGAGCTGCGGTGG - Intronic
988998473 5:36737447-36737469 ATGGCAGCCCTGCGCTGAGGAGG + Intergenic
996325475 5:122267864-122267886 GTACCAGCCCAGAGCTGGGTAGG + Intergenic
997594882 5:135100550-135100572 GTGGCAGCCAAGAGCTGTCCTGG - Intronic
999257352 5:150216931-150216953 CTGGGAGCCCAGAACTGTGGCGG - Intronic
1001453758 5:171845594-171845616 CGGGCAGCCCAGAGCTGGGCAGG + Intergenic
1002108044 5:176889889-176889911 GTGGGAGCCCAGAGCATCTGTGG - Intronic
1002182778 5:177440191-177440213 GTGGCCGCCTGGAGCTGAGGTGG + Intronic
1002330381 5:178436629-178436651 GTGGCATCCCTGTGCAGCGGTGG + Intronic
1003302999 6:4901935-4901957 GTGGCAGCCCAGAGCTGCGGGGG - Intronic
1003402180 6:5799772-5799794 GCGGCTGCCCAGGGCTGTGGGGG - Intergenic
1006154961 6:32009001-32009023 GAGGCGGCTCAGAGCTGGGGTGG - Intergenic
1006161272 6:32041736-32041758 GAGGCGGCTCAGAGCTGGGGTGG - Intronic
1006437459 6:34033368-34033390 GAGGTATCCCAGAGCTGCAGGGG + Intronic
1006946373 6:37787116-37787138 GTGCCATCCCAGATCTGAGGTGG + Intergenic
1011736214 6:90313219-90313241 GTGGAGGCCCAGGGCTGGGGTGG + Intergenic
1016276001 6:142353185-142353207 GTGGGAGCCCATAGCTTGGGTGG - Intronic
1017905104 6:158752687-158752709 GGGGTAGCCCAGAGCTGCAGAGG + Intronic
1017925507 6:158908755-158908777 GGTGCAGCCCAGAGCTGCTAGGG - Intronic
1018919548 6:168161637-168161659 GTGTCAGTGCAGAGCTGAGGCGG - Intergenic
1019841727 7:3453030-3453052 GTAGCAGGACAGAGCTGAGGAGG - Intronic
1020274284 7:6615475-6615497 GCGGCTGCCTAGAGCGGCGGCGG + Intergenic
1021658016 7:22891022-22891044 GTGGCTGCCCCGAGATGGGGTGG - Intergenic
1022632538 7:32098866-32098888 GTGGCAGCCAGGGGCTGAGGAGG + Intronic
1023874343 7:44278568-44278590 GAGGCAGCCCAGGGCAGCAGAGG + Intronic
1025878429 7:65509313-65509335 GTGGCAGCAGAAAGCCGCGGCGG + Intergenic
1026252650 7:68684373-68684395 GTGGCTGCTCAGAGTTGGGGTGG - Intergenic
1029494568 7:100890010-100890032 TTGGCAGCCCAGAGGGGCGAAGG + Exonic
1034063022 7:148110387-148110409 GTGACAGCCCAGAGCAGCCCAGG + Intronic
1034282596 7:149864412-149864434 GTGGCATCCCAGAGCAGCAGGGG + Exonic
1034837929 7:154369762-154369784 GTGGCAGCTCAGAGCTGGGCTGG - Intronic
1035237320 7:157507111-157507133 GTGGCAGCCAGGAGCTGGGGTGG - Intergenic
1036485380 8:9174414-9174436 GTGGCAGCTTAGAGCTCCAGAGG + Intergenic
1037989072 8:23307676-23307698 GTGGAAGCCCTGGGCGGCGGGGG - Intronic
1043731916 8:83694077-83694099 GTGGGAGCCCACGGCAGCGGGGG + Intergenic
1043982398 8:86657605-86657627 TTGGCAGCCCCGAGCTCCTGTGG + Intronic
1044306563 8:90646255-90646277 GCGGAGGCCCACAGCTGCGGAGG + Intronic
1044427216 8:92065948-92065970 GTGGCAGGCCAGAGCAGATGGGG - Intronic
1044605330 8:94042909-94042931 GTGGGAGGCAAGAACTGCGGTGG - Intergenic
1047515096 8:125547056-125547078 GTGGCAGTCCAGAGTGGAGGAGG + Intergenic
1049578794 8:143401529-143401551 GAGGCGGCCCAGAGATGGGGAGG + Intergenic
1049615306 8:143573268-143573290 GGGGCAGCCCGGAGGTGTGGAGG + Intergenic
1049943678 9:574004-574026 TTGGAAGCACAGAGCTGCGGCGG - Intronic
1052249124 9:26376201-26376223 GTGGCTGCCCAGGGCTGGGCAGG + Intergenic
1053130230 9:35610370-35610392 GTGGCTGTCGAGAGCTGAGGAGG - Intronic
1053667285 9:40325129-40325151 GGGGCAATCCAGAGCTGTGGGGG + Intronic
1053715619 9:40884847-40884869 GTGGCTTCCCGGAGCTGCAGTGG + Intergenic
1053916866 9:42950234-42950256 GGGGCAATCCAGAGCTGTGGGGG + Intergenic
1054076930 9:60545891-60545913 GTGGCTTCCCAGAGCTGCAGTGG - Intergenic
1054378430 9:64465157-64465179 GGGGCAATCCAGAGCTGTGGGGG + Intergenic
1054517325 9:66051154-66051176 GGGGCAATCCAGAGCTGTGGGGG - Intergenic
1054817076 9:69485794-69485816 GTGGAATCCCAAAGCTGTGGTGG - Intronic
1055366557 9:75550460-75550482 GTGGCAGGGCAGATCTGTGGAGG - Intergenic
1056671999 9:88638373-88638395 CTGCCAGCCAAGAGCTGGGGTGG - Intergenic
1057140422 9:92723540-92723562 GTGGCTGCCAGGAGCTGGGGAGG + Intronic
1058803789 9:108569999-108570021 CTGACAGCACAGAGCTGCTGGGG - Intergenic
1060156601 9:121324656-121324678 GCTGCAGCCCAGAGAGGCGGTGG - Intronic
1060485855 9:124045750-124045772 CTGGCAGCCCAGAGCCGGCGAGG - Intergenic
1060544277 9:124451173-124451195 GTGGCTGCACGGAGCAGCGGTGG + Intergenic
1061220226 9:129246333-129246355 GTGATAGCCCAAAGCTGCGTGGG + Intergenic
1061486537 9:130923278-130923300 TTGTCAGCCCATAGCTGTGGGGG + Intronic
1061892347 9:133629463-133629485 GTGGCAGCCGCGAGCTCCAGGGG + Intergenic
1062282635 9:135758869-135758891 GGGGGTGCCCAGAGCTGCGAGGG + Intronic
1062312705 9:135947771-135947793 GTGTCAGCCCAGAGCGGCGGCGG - Intronic
1062318087 9:135978043-135978065 GGGGCATCCCAGGGCTGCTGAGG - Intergenic
1062381234 9:136287788-136287810 GTGGCTGCCAAGGGCTGGGGAGG + Intronic
1062462993 9:136669627-136669649 GGGCCAGCCCAGGGCTGCGGCGG - Exonic
1062554330 9:137107154-137107176 GTGGGAGCCCAGCGCTGCCTCGG - Intronic
1203573811 Un_KI270744v1:157814-157836 GTGGGAGCCCACAGCTGCAGTGG + Intergenic
1191851373 X:65588483-65588505 GGGGCAGCCATGAGCTCCGGGGG + Intronic
1193368248 X:80660469-80660491 GTGGTTGCCAAGAGCTGGGGTGG - Intergenic
1193497853 X:82236607-82236629 ATAGCACCCCAGAGCTGCAGTGG - Intergenic
1197240089 X:124114328-124114350 GGGGCAGCCTAGTGCTGGGGTGG + Intronic
1199798530 X:151227126-151227148 GTGGGAGCCCAGGTCTGCTGGGG + Intergenic
1199885889 X:152021771-152021793 GTGGCAGCTCAGAGCTCCAAGGG - Intergenic
1202374181 Y:24218263-24218285 GGGGGAGCCCAGAGGTGCTGGGG + Intergenic
1202496600 Y:25451857-25451879 GGGGGAGCCCAGAGGTGCTGGGG - Intergenic