ID: 1003303791

View in Genome Browser
Species Human (GRCh38)
Location 6:4908367-4908389
Sequence TGGATAGGTGGTATGTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003303791 Original CRISPR TGGATAGGTGGTATGTCCTT GGG Intronic
900883449 1:5398939-5398961 TGGAGAGGTCTCATGTCCTTTGG + Intergenic
902360452 1:15939637-15939659 TGGGTTGGTGATGTGTCCTTGGG - Exonic
907185827 1:52608317-52608339 TGGAAAGGTGGTAGGGGCTTGGG + Exonic
907789410 1:57647369-57647391 TGGAGAGGTGGTAACTCCTTGGG + Intronic
908862303 1:68503189-68503211 TGGCTATGTGGAATGTTCTTTGG - Intergenic
909916855 1:81330543-81330565 TGGAGAATTTGTATGTCCTTGGG + Intronic
910560973 1:88590573-88590595 TTGATAGGTTGTATGTGCCTAGG - Intergenic
912594222 1:110858095-110858117 TTGGTAGGTGGTGTGTCGTTGGG - Intergenic
916375265 1:164146993-164147015 TAGGTAGGTGGTCTGTCCTTTGG + Intergenic
917073846 1:171182679-171182701 TGGATGGGTGGTAAGGCCTATGG + Intergenic
917533904 1:175860906-175860928 TGGATAGGTGGGCGGTCCTCAGG - Intergenic
918636014 1:186775027-186775049 AGGATTGATGGTCTGTCCTTAGG + Intergenic
920491834 1:206422023-206422045 TGCATAGCTGGTATGAGCTTAGG - Intronic
924772054 1:247087604-247087626 TGGTCAGGTGGTGTGTCCCTGGG - Intergenic
1063398674 10:5719085-5719107 TGGCTTGGTGGTTTGGCCTTTGG + Intronic
1063707374 10:8443684-8443706 AGGATAGATGGTATTTACTTTGG + Intergenic
1065041400 10:21701054-21701076 TGGGTAGGTTGTATGTTTTTTGG + Intronic
1068889906 10:62137984-62138006 TGGGTAGGTGATGTGTCCTGAGG + Intergenic
1069119777 10:64555520-64555542 TGACTGGGTGTTATGTCCTTTGG + Intergenic
1072264004 10:93710235-93710257 TGGATAGGTGGAATTTTCTGGGG + Intergenic
1074678747 10:115881938-115881960 AGGATAGGTGGTATGCATTTAGG - Intronic
1076691489 10:132225866-132225888 TGGGTTGGTGGGATGTCCTGGGG - Intronic
1078114370 11:8430751-8430773 TGGATAGCTACTATGTGCTTTGG - Intronic
1078941232 11:16008444-16008466 TGGATAGCTGGTTTCTCATTGGG - Intronic
1082215908 11:49569243-49569265 TTGATTGGCGGTGTGTCCTTAGG - Intergenic
1087273842 11:96140681-96140703 TGGAGTGGTGGAAGGTCCTTTGG - Intronic
1091117427 11:133026850-133026872 TGAATAGTTGATATGTCGTTTGG + Intronic
1093284791 12:17245648-17245670 TGAAAAGGTGGAATGTCCCTTGG + Intergenic
1097568671 12:61303390-61303412 TGGTTAGATGGTATGGCTTTTGG - Intergenic
1098007247 12:66010609-66010631 CAGATAGGTGCTCTGTCCTTGGG - Intergenic
1098793135 12:74852591-74852613 TGGGTAGGTGGTATTTTCCTGGG + Intergenic
1100708734 12:97230719-97230741 TGGTTTGGTGCTATGTCCTGGGG + Intergenic
1113800302 13:113082932-113082954 TTGCTATGTGGTATGGCCTTCGG - Intronic
1118556344 14:67027055-67027077 TTGATAGCTGGTATATCCGTGGG + Intronic
1120775284 14:88428480-88428502 AGGATAAGTGATTTGTCCTTGGG - Intronic
1122305915 14:100766313-100766335 TGGCAAGGGGGTATGACCTTGGG + Intergenic
1126213550 15:46128215-46128237 TTGATAGGTTGTATGTTCCTAGG + Intergenic
1126291962 15:47091185-47091207 TAGATAGGTGCTAGTTCCTTGGG - Intergenic
1126656441 15:50982771-50982793 GGAATAGGTGATATTTCCTTTGG + Intronic
1129584068 15:76844631-76844653 TTGATAGGTGGTATGTGTCTTGG - Intronic
1130058696 15:80553176-80553198 TGTATAGGTGGCACGTCTTTAGG + Intronic
1138096192 16:54213780-54213802 TGGATAGGTTGTGTGCCCTTGGG + Intergenic
1138113920 16:54345323-54345345 TGGACAGTGGGCATGTCCTTGGG - Intergenic
1140380802 16:74485456-74485478 AGGATAGGTGGTACATACTTTGG - Intronic
1140523471 16:75602300-75602322 TGGGAAGGTGATATGTCCTGAGG + Intronic
1140704872 16:77618317-77618339 TGGATAAGTGGATTGACCTTCGG - Intergenic
1203029546 16_KI270728v1_random:563246-563268 TGGATAGTTGGGAGCTCCTTGGG + Intergenic
1203042175 16_KI270728v1_random:771185-771207 TGGATAGTTGGGAGCTCCTTGGG - Intergenic
1144815019 17:18028000-18028022 TGGATGGCTGGTTTCTCCTTTGG - Intronic
1146796581 17:35785372-35785394 TGGCTAACTTGTATGTCCTTAGG + Intronic
1153099903 18:1455412-1455434 TTGATAGGTTGTATGTACATAGG - Intergenic
1155122832 18:22840869-22840891 TGGCTAGGAAGTATGGCCTTCGG - Intronic
1159121238 18:64173986-64174008 TGAATAGGTTGTATTTTCTTGGG + Intergenic
1166828163 19:45622086-45622108 TGGGTAGGTGGCAGGTGCTTGGG - Intronic
925285615 2:2713798-2713820 TGCATAGGTGGTGAGTCCCTGGG - Intergenic
930426227 2:51216390-51216412 TTTATAGGTGATATGTCTTTTGG - Intergenic
932330379 2:70895287-70895309 TGGATAGGTGGTAGGTCCAGAGG + Intergenic
935517104 2:104053514-104053536 TGGAAAGATTGAATGTCCTTTGG + Intergenic
937154925 2:119712137-119712159 TAGATATGTGGTATGGCCTGGGG + Intergenic
945169824 2:206983849-206983871 TGGGTAGTTGGTATCTCATTAGG - Intergenic
946199102 2:218060850-218060872 TGGATGGGTAGAAGGTCCTTCGG + Intronic
948526730 2:238575296-238575318 AGGAAAGGTGGTAAGCCCTTTGG - Intergenic
1174315674 20:49698979-49699001 TTGATAGGTGGTTTTTGCTTAGG - Intronic
1175187138 20:57186379-57186401 TGGATAGATAGTGTGTTCTTAGG - Intronic
1175437339 20:58962923-58962945 TGGAAAGTTTATATGTCCTTGGG - Intergenic
1178482218 21:32989435-32989457 TGGGTAAGTAGCATGTCCTTGGG - Intergenic
1185382672 22:50517356-50517378 TGGATAGCTGGGAAGGCCTTGGG + Intronic
950353013 3:12375697-12375719 TGGATGGGTGCCCTGTCCTTAGG + Intronic
951794245 3:26520217-26520239 TTGGTAGGTTGTATGTACTTAGG + Intergenic
951803273 3:26620920-26620942 TGGATAGCAGGTATGTAATTTGG - Intergenic
953468613 3:43147143-43147165 TGGGTAGGGGGTATCTCATTGGG + Intergenic
953625254 3:44565621-44565643 TGGGGAGGTGGTGTGTCCCTGGG - Exonic
954517685 3:51193640-51193662 TTGATAGGTTGTATGTTTTTAGG + Intronic
958545281 3:95540209-95540231 TGGAAAGGTGTTATTTCCTAAGG + Intergenic
961408621 3:126702639-126702661 TGGATAGATGGTATGTTTCTGGG - Intergenic
965414835 3:168380272-168380294 TTGATAGGTTGTATGTCTCTAGG + Intergenic
967571972 3:191040005-191040027 TTGATAGGTGGTATGTGTCTAGG + Intergenic
968259747 3:197310918-197310940 TGGACAGGAGGGATTTCCTTGGG - Intergenic
974646895 4:64705795-64705817 GGGATACATGGTATGACCTTAGG + Intergenic
976671375 4:87658227-87658249 TGGACTGGGGGTATCTCCTTAGG - Intronic
987194624 5:15513968-15513990 TGGAGAGGCAGTATTTCCTTGGG + Intronic
988140647 5:27234868-27234890 TGCATAGCTGGTAAGGCCTTAGG - Intergenic
989290142 5:39754675-39754697 TGGATAGGTGGAACATACTTAGG + Intergenic
993429228 5:87811188-87811210 TCGATAGGTGGTATATCCCAAGG + Intergenic
1000359685 5:160435552-160435574 TGGGAAGGGGGTATGTCCTGTGG + Intergenic
1002777542 6:341725-341747 TGGATAGGAGCTATGTCCTGTGG + Intronic
1003303791 6:4908367-4908389 TGGATAGGTGGTATGTCCTTGGG + Intronic
1006086958 6:31602839-31602861 TGGATGGCTTTTATGTCCTTGGG - Intergenic
1009284419 6:61797916-61797938 TGGATAAGTTGCATGTCATTGGG + Intronic
1009292291 6:61897397-61897419 TGGATTGCTGGTGTGACCTTGGG - Intronic
1011362555 6:86543470-86543492 TGGATAAGTTGCATGTCATTGGG - Intergenic
1014714013 6:124842672-124842694 TGGGAAGGTGGTGTGACCTTGGG - Intergenic
1014918287 6:127181157-127181179 TGTATAGCTGCTATGACCTTGGG - Intronic
1015052558 6:128859769-128859791 TGGATAGGTTGTATGTGTCTAGG + Intergenic
1015957451 6:138613584-138613606 TGGACAGGTGGCATGGCCATGGG - Intronic
1016559687 6:145381590-145381612 TGGATGGGTGTTATTTCTTTAGG - Intergenic
1016578886 6:145605094-145605116 GGGAAAGGTTGTATATCCTTTGG + Intronic
1017041932 6:150314978-150315000 CAGATAGGTGGCCTGTCCTTAGG + Intergenic
1018323450 6:162637557-162637579 TGGATAGAAGGAATGTCCATGGG - Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1022756597 7:33299102-33299124 TAGATTGGTTGCATGTCCTTTGG - Intronic
1023922323 7:44639234-44639256 TGGAGAAGAGGTATCTCCTTGGG + Intronic
1024209859 7:47193927-47193949 GGGATGGGTGGTGTCTCCTTAGG - Intergenic
1025529953 7:61867459-61867481 TGGATAGTTGGGAGCTCCTTGGG - Intergenic
1027674923 7:81145274-81145296 TTGATAGGTTGTATGTGCCTAGG - Intergenic
1029061887 7:97806685-97806707 TGGTTTGGTGGGGTGTCCTTGGG - Intergenic
1032552020 7:132792956-132792978 TAGAGAGGTGGTATGTCCCAGGG + Intronic
1035186309 7:157128689-157128711 AGGAGAGGTGGTGTGTCCTTTGG + Intergenic
1035468674 7:159096194-159096216 TGGATAGGAGGCCTGTCTTTGGG - Intronic
1038670006 8:29575290-29575312 TGGAAAGTTTGTATGTCCTGAGG - Intergenic
1039629555 8:39094648-39094670 TGGATAGGTTGTATGTTTCTAGG + Intronic
1043230438 8:77793750-77793772 CGTATTTGTGGTATGTCCTTAGG - Intergenic
1046790553 8:118317129-118317151 TGTAGAGGTGGTCTCTCCTTAGG - Intronic
1050057413 9:1670316-1670338 TGGATAGTTAGTATGCTCTTTGG + Intergenic
1053022794 9:34707616-34707638 AGGATAGGTGGTAAGTGCTGTGG + Intergenic
1055752089 9:79517790-79517812 AGGATAGGAGGTGTCTCCTTTGG - Intergenic
1056396711 9:86187657-86187679 TGGTGAGCTGGTATGACCTTTGG - Intergenic
1057880484 9:98789347-98789369 TTGAAACGTGGTATGTCCTATGG + Intronic
1058977731 9:110140271-110140293 TGGCTAACTTGTATGTCCTTTGG + Intronic
1061250272 9:129422337-129422359 TGGCCAGGTGGTGTGACCTTGGG + Intergenic
1061744949 9:132732849-132732871 TGGATATATGATGTGTCCTTTGG - Intronic
1187837041 X:23442615-23442637 TTGATAGGTTGTATGTGTTTAGG - Intergenic
1188494007 X:30764681-30764703 TGGATATTTAGTATGGCCTTAGG - Intergenic
1191188914 X:57644693-57644715 TGGATAGGTTGTATGTGTCTGGG - Intergenic
1193358291 X:80549439-80549461 TTGATAGGTTGTATATGCTTAGG + Intergenic
1194157603 X:90411913-90411935 TTGATAGGTTGTATGTGTTTAGG + Intergenic
1198443578 X:136688960-136688982 GGCATAGGGGATATGTCCTTTGG + Intronic
1199037330 X:143067469-143067491 TTGGTATGTGGTATGTACTTAGG - Intergenic
1200503936 Y:3988886-3988908 TTGATAGGTTGTATGTGTTTAGG + Intergenic
1200791667 Y:7304880-7304902 GTGTTAGGTGGTGTGTCCTTTGG - Intergenic
1201700353 Y:16874492-16874514 TGGCTTGGTGGTATGTGCTGTGG - Intergenic