ID: 1003304927

View in Genome Browser
Species Human (GRCh38)
Location 6:4917798-4917820
Sequence GTAATTACCCAGAGTAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003304927_1003304932 23 Left 1003304927 6:4917798-4917820 CCCTCCTTACTCTGGGTAATTAC 0: 1
1: 0
2: 2
3: 8
4: 157
Right 1003304932 6:4917844-4917866 CTGAAGTTCTGCCCTCTGTGAGG 0: 1
1: 0
2: 6
3: 30
4: 221
1003304927_1003304930 -3 Left 1003304927 6:4917798-4917820 CCCTCCTTACTCTGGGTAATTAC 0: 1
1: 0
2: 2
3: 8
4: 157
Right 1003304930 6:4917818-4917840 TACAGATGTACTTCCAAATGAGG 0: 1
1: 0
2: 0
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003304927 Original CRISPR GTAATTACCCAGAGTAAGGA GGG (reversed) Intronic
901947010 1:12712258-12712280 GTAATTCCCAAGAGTCAGTAAGG + Intergenic
903469261 1:23574352-23574374 GAAATCAACCAGAGTAAGGTGGG - Intergenic
907307509 1:53521554-53521576 GTAATGACACAGAGTGACGATGG + Intronic
908746003 1:67377132-67377154 CTGATTACCCATAGTAAGCAGGG + Intronic
909131197 1:71739135-71739157 GTATCCACCCAGATTAAGGATGG - Intronic
912043531 1:105421885-105421907 GTACTTACCCAGAGGATGGATGG - Intergenic
1071855714 10:89622351-89622373 GTAATTACCCAGTGTTGGCAAGG + Intronic
1073218645 10:101851529-101851551 GAAATAAGCCAGAGTCAGGATGG + Intronic
1076276398 10:129202952-129202974 GTGATTAAGCTGAGTAAGGAAGG - Intergenic
1080759337 11:35233050-35233072 TCAGTTACACAGAGTAAGGAAGG - Intergenic
1081271482 11:41089398-41089420 GTCATTACCTGGAGTAATGATGG - Intronic
1081565055 11:44255488-44255510 GTAAACACCCAGGTTAAGGAAGG - Intergenic
1084354144 11:68626006-68626028 GAAACTACCCAAAGTAAAGACGG + Intergenic
1087957672 11:104308978-104309000 GTGCTTACCCAGAATAAGGGTGG - Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1090209165 11:124905577-124905599 GTGCTCACCCAGATTAAGGATGG + Intergenic
1091009945 11:131991735-131991757 CTAATTACCCAGATAAAGAAAGG + Intronic
1091304584 11:134529510-134529532 CTAAGGACTCAGAGTAAGGAGGG - Intergenic
1091556145 12:1574775-1574797 GTAAGTCCCCAGAGTAAGGCGGG - Intronic
1091606596 12:1958257-1958279 GTCATTACCCAGAGCAACGTTGG - Intronic
1092225987 12:6748747-6748769 GTAAGTATCAGGAGTAAGGAGGG - Intronic
1095150295 12:38786351-38786373 GTGCTCACCCAGAGTAAGGGTGG - Intronic
1097628537 12:62031222-62031244 GTGACCACCCAGATTAAGGATGG - Intronic
1098296176 12:69006335-69006357 GTAATTATCAATAGAAAGGACGG - Intergenic
1100676814 12:96877791-96877813 GAAAATACCCACAGTAAAGAAGG - Intergenic
1100892729 12:99144198-99144220 GTAGTTATCAAGTGTAAGGATGG + Intronic
1104326266 12:127801687-127801709 ATAATTTCCCAAAGTAAGTAGGG + Intergenic
1105947095 13:25199426-25199448 GAAATTACCCAGAGGATGGAGGG - Intergenic
1109170208 13:59086043-59086065 ATAAGAAACCAGAGTAAGGATGG + Intergenic
1112799551 13:103095378-103095400 GTAATTTCCCAGGGTAGGGGTGG + Intergenic
1112846372 13:103648027-103648049 GAAATTACCCAGTCTGAGGATGG - Intergenic
1113126501 13:106984910-106984932 TAAATTACCCAGTGTAAGAATGG + Intergenic
1114205080 14:20563404-20563426 ATAAGGACCCAGAGGAAGGAAGG - Intergenic
1115406234 14:33020425-33020447 GTAAGTACCCAGAGTAATGCAGG + Intronic
1117346221 14:54835533-54835555 ATAGTTACACAGAATAAGGAGGG + Intergenic
1120116783 14:80627143-80627165 GCAATATCTCAGAGTAAGGAAGG + Intronic
1121765396 14:96481296-96481318 GTAACTACTCAGAGTAATCAGGG + Intronic
1121855191 14:97262545-97262567 GTATTTCCCAAGAGAAAGGACGG + Intergenic
1124180888 15:27472667-27472689 GTAATGACAAATAGTAAGGAAGG + Intronic
1125160789 15:36641242-36641264 ATAATTACACAGAATAAGAATGG + Intronic
1131223353 15:90603734-90603756 GTATTTGCCCAGAGAATGGATGG - Intronic
1133461248 16:5988499-5988521 CTAAGTTCCCAGAGGAAGGAGGG + Intergenic
1133744960 16:8679347-8679369 GAATTTCCCCACAGTAAGGAAGG - Intronic
1134901083 16:17938639-17938661 GCAATTCCACAGATTAAGGAGGG - Intergenic
1143047585 17:4094642-4094664 GTTTTTCCCCAGAGTAAGAAAGG + Intronic
1149123741 17:53202627-53202649 GTAATTGCCCAAAGTGATGAAGG + Intergenic
1149254949 17:54815650-54815672 GTGCTGACCCAGATTAAGGATGG - Intergenic
1149514692 17:57271601-57271623 GTAAAAACCCAGATGAAGGAAGG - Intronic
1151134072 17:71928138-71928160 GTACCCACCCAGAGTAAGGGTGG - Intergenic
1151439779 17:74120657-74120679 GAAATGACCCAGAGAAGGGAAGG + Intergenic
1151869811 17:76828715-76828737 GTAATGTCCCACAGTAAGCAAGG + Intergenic
1152522852 17:80870033-80870055 CTAATTAGCAAGATTAAGGAGGG + Intronic
1153502047 18:5759816-5759838 GTAATTACAAAAAGGAAGGAAGG + Intergenic
1156487702 18:37477135-37477157 GAACTGACCCAGAGCAAGGATGG - Intronic
1156971350 18:43160955-43160977 GTAATTACACATAGAAAGGCTGG + Intergenic
1159211322 18:65326354-65326376 GGAATTGCCCAGAGTACAGATGG - Intergenic
1159492862 18:69161373-69161395 GTAATCACACAGATAAAGGAAGG + Intergenic
1161396426 19:4047192-4047214 GTAAGTGCCCTGAGGAAGGAGGG + Exonic
1161917264 19:7238036-7238058 TTCATTTCCCAGAGGAAGGATGG + Intronic
1164973799 19:32554946-32554968 TTAATTACCAAGAGGAAAGAGGG - Intergenic
1166730932 19:45058740-45058762 GTGATAAGCCAGAGGAAGGAGGG - Intronic
1166748695 19:45154306-45154328 GTGATGACCCAGAGTAGGAATGG - Intronic
1167120237 19:47512412-47512434 GGAATTACCTACTGTAAGGAGGG - Intronic
925651288 2:6092178-6092200 CTATTTGCCCAGAGTCAGGATGG - Intergenic
933182595 2:79244084-79244106 GTAATTCCCCAACATAAGGAAGG - Intronic
933338544 2:80992078-80992100 GTCATTAACCACAGTATGGATGG + Intergenic
934732194 2:96666384-96666406 GAAATTGCCCAGGTTAAGGAAGG - Intergenic
934937141 2:98473566-98473588 GCCAGTGCCCAGAGTAAGGAGGG - Intronic
937405082 2:121620235-121620257 GAAATTACCCAGAATTAGCAGGG + Intronic
939858596 2:147390989-147391011 GTAATTACCCAAAGGAGTGATGG - Intergenic
939870243 2:147518806-147518828 GTACCTGCCCAGATTAAGGATGG - Intergenic
939977738 2:148738573-148738595 GTAAATAACCAGAGAAAAGAGGG + Intronic
940410472 2:153357700-153357722 GTAATAAACCTGAGTGAGGATGG - Intergenic
940620545 2:156107611-156107633 GTAATTACCCAGGGATAGAATGG - Intergenic
941325348 2:164107509-164107531 GTAATGAACCAGAATACGGAGGG - Intergenic
942436841 2:175988016-175988038 TTCTTTACCCAAAGTAAGGAAGG - Intronic
945486058 2:210397166-210397188 GTAATTAAGAAGACTAAGGATGG - Intergenic
947298365 2:228658772-228658794 GTAATATCCCACAGCAAGGAAGG - Intergenic
949342266 3:3042798-3042820 GAAATTATCCAAAGTAAGAAGGG - Intronic
950430756 3:12949659-12949681 TTAGTCACCCAGAGGAAGGAAGG + Intronic
951349375 3:21586794-21586816 AAAATAACCCAGAGTAATGAAGG + Intronic
951422879 3:22508934-22508956 GTAATTACTCAGGGAAATGAGGG - Intergenic
951796341 3:26542978-26543000 GTGATTACCAAGGGCAAGGAGGG - Intergenic
952670842 3:35966270-35966292 GTAATGACCCTGAGTCTGGAAGG - Intergenic
953182231 3:40606675-40606697 ATAATCATCCAGAGTAAGGTAGG + Intergenic
954043714 3:47910846-47910868 GTCAATAACCAGAGCAAGGAAGG - Intronic
956308355 3:67851623-67851645 CTAAATACCCAGAGTAAGTCAGG - Intergenic
957352015 3:79036690-79036712 ATAATGACCCAAAGTAAAGAAGG + Intronic
957486445 3:80868713-80868735 TTAATTACTCAGCGTAAAGAGGG - Intergenic
957907324 3:86574371-86574393 GTATATACCCAGAAGAAGGATGG - Intergenic
962307654 3:134302504-134302526 GAAATTAACCATAGTAAGAATGG + Intergenic
963462395 3:145633279-145633301 GTACTCACCCAGAGTAAGGATGG - Intergenic
964251383 3:154721895-154721917 TTTATTACACAGAATAAGGAAGG - Intergenic
966985024 3:185172248-185172270 GTAATTATCCAGATGAAGAAAGG - Intergenic
967329349 3:188275153-188275175 GTGATGACCCAAAGTCAGGATGG - Intronic
970928236 4:21478153-21478175 GAAATTAACCAGATTAAGAAAGG - Intronic
971348539 4:25835187-25835209 TGGATTACCCAGTGTAAGGATGG - Exonic
972112555 4:35583105-35583127 ATAATTTCCAAAAGTAAGGAGGG + Intergenic
974316246 4:60284935-60284957 ATAATTAAACAGAGTAAGAAAGG + Intergenic
975013024 4:69378888-69378910 GGAATTACACAGGGAAAGGAGGG + Intronic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
977589720 4:98813185-98813207 GTATTTACCCAGGTAAAGGATGG + Intergenic
980108511 4:128611832-128611854 GTGCTCACCCAGATTAAGGATGG - Intergenic
980392194 4:132161471-132161493 GTAATTACCAGGTGTAAAGAGGG - Intergenic
981429275 4:144641587-144641609 GTGATTCCACAGAGGAAGGACGG - Intergenic
982606402 4:157521794-157521816 GTATTCACCCAGATTGAGGATGG + Intergenic
984603844 4:181760884-181760906 GTTAAAACCCAGGGTAAGGAAGG - Intergenic
987544120 5:19289984-19290006 GTAAAGACCCAGAATAATGAAGG + Intergenic
987958440 5:24770790-24770812 TTAATTCCCAAAAGTAAGGAGGG - Intergenic
988354376 5:30153698-30153720 GTAATTTGCCTGAGAAAGGAAGG + Intergenic
988705517 5:33722800-33722822 GTCATGACCCAAAGTCAGGAAGG + Intronic
990889571 5:60633318-60633340 GGAAGTCACCAGAGTAAGGAAGG - Intronic
993907268 5:93637089-93637111 GTAGTTGCCAAGGGTAAGGAGGG - Intronic
995377559 5:111493148-111493170 GGACCTACCCAGAGTAAGGAAGG - Exonic
996194135 5:120582764-120582786 GAAATTGCCCAGAGTATGGGAGG + Intronic
996886036 5:128354567-128354589 GTAATTACGAAGAGAAATGATGG + Intronic
997333015 5:133080998-133081020 GTAATTGCCTAGGGTATGGAGGG - Intronic
1000506412 5:162125754-162125776 AAACTTACACAGAGTAAGGAAGG + Intronic
1000730745 5:164830765-164830787 GTACCTACCCAGATTAAGGGTGG - Intergenic
1002293002 5:178212326-178212348 GTGATCACCCAGAGGTAGGAGGG + Intronic
1003304927 6:4917798-4917820 GTAATTACCCAGAGTAAGGAGGG - Intronic
1005236190 6:23764857-23764879 TCAATTACTCAGATTAAGGAAGG - Intergenic
1008996640 6:57667440-57667462 GTAACTACTCAGAATAAGCAAGG - Intergenic
1010178340 6:73055598-73055620 GTATTTCCCCAGATCAAGGAGGG + Intronic
1010804395 6:80217864-80217886 GTTTTTAACCAGAGTCAGGAAGG + Intronic
1011580927 6:88863730-88863752 TTAAATACCAAGTGTAAGGAAGG + Intronic
1012109501 6:95210903-95210925 GTACTTACCCACAGTCAGAAAGG + Intergenic
1012804663 6:103878926-103878948 GCAAATACCCAGGGTAAGTAAGG - Intergenic
1014220462 6:118794001-118794023 GTGCTCACCCAGATTAAGGATGG - Intergenic
1020950418 7:14669102-14669124 GTCATTAGCTAGAGTGAGGATGG - Intronic
1023131306 7:37005944-37005966 GTAATTACCCACAGCTAGGATGG - Intronic
1024280493 7:47715042-47715064 GTAAGCACCCACAGTACGGAGGG + Intronic
1024565094 7:50674069-50674091 CTCACTACCCAGAGTAGGGACGG - Intronic
1030450239 7:109700042-109700064 GTGATAACCCAGATTGAGGATGG - Intergenic
1030997697 7:116378268-116378290 AGGATTACCCAGAGAAAGGAAGG + Intronic
1031779506 7:125943356-125943378 GTATTCACCCAGATTAAGGGTGG - Intergenic
1032188096 7:129745052-129745074 GGAGTTACTCAGAGTTAGGAAGG - Intronic
1032209244 7:129897146-129897168 GTAATTATCCAGTGTAGGGAAGG - Intronic
1033618913 7:143044426-143044448 CTAATTTTTCAGAGTAAGGAAGG - Intergenic
1037104044 8:15083212-15083234 GTAATTAACCAGAGAAAGGTGGG - Intronic
1037889693 8:22617352-22617374 ATAATTACCAATAGTAAGCATGG - Intronic
1038997998 8:32946342-32946364 GAAAATACCCAAAGCAAGGAAGG - Intergenic
1040627549 8:49167943-49167965 CTAATTACCAATACTAAGGAAGG + Intergenic
1044030876 8:87235360-87235382 ATGATTAACCTGAGTAAGGAAGG - Intronic
1045057650 8:98382975-98382997 GAAGGTTCCCAGAGTAAGGAGGG - Intergenic
1046337269 8:112806698-112806720 GTAATGAGGCAGAGAAAGGATGG + Intronic
1046417293 8:113934685-113934707 GTACCCACCCAGATTAAGGATGG + Intergenic
1050777327 9:9282082-9282104 ATAGTTACCCAGAGTAAGGAAGG + Intronic
1052419796 9:28227942-28227964 TTAATTATCCAGAGTAATTAGGG + Intronic
1055761468 9:79613450-79613472 GTAACTACCAAAAGTAAGCAGGG - Intronic
1055804072 9:80073668-80073690 GTAAATACCCAGAGAAAAGTGGG - Intergenic
1059186187 9:112273712-112273734 GTCACTACCCAGAGGAAGGCTGG + Intronic
1059552917 9:115248022-115248044 GTACCCACCCAGATTAAGGATGG - Intronic
1061828756 9:133277342-133277364 GTATTTTACCACAGTAAGGAAGG + Intergenic
1186304848 X:8245314-8245336 GTACCCACCCAGAGTAAGGGTGG + Intergenic
1186406166 X:9305416-9305438 GTAATTACTCAGAATATAGAAGG - Intergenic
1186550984 X:10505437-10505459 GTAATTAATAAGAGAAAGGAAGG - Intronic
1187633425 X:21200588-21200610 GTGCTCACCCAGATTAAGGATGG - Intergenic
1187774479 X:22740337-22740359 GTAATTACCTGGAGTAAACAAGG - Intergenic
1188970339 X:36607379-36607401 GATATTACCCAGAGCAGGGAGGG - Intergenic
1189996805 X:46646814-46646836 ATAGTTCCCCAGATTAAGGAGGG - Intronic
1193149248 X:78107403-78107425 GTAGTTACCAGGAGTCAGGAAGG - Intronic
1194056494 X:89140670-89140692 GAAATTACCCATAGTAATTATGG - Intergenic
1194133209 X:90106828-90106850 GGCATTACCCAGAGAGAGGAAGG - Intergenic
1194155784 X:90387033-90387055 GTAATGTCCCAGTGCAAGGATGG + Intergenic
1196274202 X:113747722-113747744 GTAATTACCCAGAGGAAATCTGG + Intergenic
1200502133 Y:3963975-3963997 GTAATGTCCCAGTGCAAGGATGG + Intergenic
1201578104 Y:15481935-15481957 TTAATTTCCCCGAATAAGGAGGG + Intergenic