ID: 1003305611

View in Genome Browser
Species Human (GRCh38)
Location 6:4924617-4924639
Sequence AAGCATATCATTAAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003305604_1003305611 24 Left 1003305604 6:4924570-4924592 CCTCACTCCCCATTGAGCTCTTG 0: 1
1: 0
2: 0
3: 22
4: 211
Right 1003305611 6:4924617-4924639 AAGCATATCATTAAGTTGGATGG No data
1003305609_1003305611 15 Left 1003305609 6:4924579-4924601 CCATTGAGCTCTTGCTGGTTGGT 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1003305611 6:4924617-4924639 AAGCATATCATTAAGTTGGATGG No data
1003305603_1003305611 28 Left 1003305603 6:4924566-4924588 CCATCCTCACTCCCCATTGAGCT 0: 1
1: 0
2: 3
3: 32
4: 314
Right 1003305611 6:4924617-4924639 AAGCATATCATTAAGTTGGATGG No data
1003305606_1003305611 17 Left 1003305606 6:4924577-4924599 CCCCATTGAGCTCTTGCTGGTTG 0: 1
1: 0
2: 0
3: 17
4: 127
Right 1003305611 6:4924617-4924639 AAGCATATCATTAAGTTGGATGG No data
1003305607_1003305611 16 Left 1003305607 6:4924578-4924600 CCCATTGAGCTCTTGCTGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1003305611 6:4924617-4924639 AAGCATATCATTAAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003305611 Original CRISPR AAGCATATCATTAAGTTGGA TGG Intronic
No off target data available for this crispr