ID: 1003306039

View in Genome Browser
Species Human (GRCh38)
Location 6:4930418-4930440
Sequence ATGGGAAACCCAGACATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003306039_1003306051 24 Left 1003306039 6:4930418-4930440 CCAGCTATGTCTGGGTTTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306039_1003306050 21 Left 1003306039 6:4930418-4930440 CCAGCTATGTCTGGGTTTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003306050 6:4930462-4930484 GCTGCTTTCGGTGGAAAGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 125
1003306039_1003306042 -4 Left 1003306039 6:4930418-4930440 CCAGCTATGTCTGGGTTTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003306042 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 2
3: 42
4: 339
1003306039_1003306048 17 Left 1003306039 6:4930418-4930440 CCAGCTATGTCTGGGTTTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003306048 6:4930458-4930480 GGCAGCTGCTTTCGGTGGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1003306039_1003306046 9 Left 1003306039 6:4930418-4930440 CCAGCTATGTCTGGGTTTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003306046 6:4930450-4930472 TGCACTGTGGCAGCTGCTTTCGG No data
1003306039_1003306047 12 Left 1003306039 6:4930418-4930440 CCAGCTATGTCTGGGTTTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003306047 6:4930453-4930475 ACTGTGGCAGCTGCTTTCGGTGG 0: 1
1: 0
2: 2
3: 11
4: 174
1003306039_1003306049 20 Left 1003306039 6:4930418-4930440 CCAGCTATGTCTGGGTTTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003306049 6:4930461-4930483 AGCTGCTTTCGGTGGAAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003306039 Original CRISPR ATGGGAAACCCAGACATAGC TGG (reversed) Intronic
901067026 1:6499028-6499050 ATGGGAAACTCCCACAAAGCTGG - Intronic
903481636 1:23657733-23657755 ATGGGAAACCCAGCCAGGACTGG - Intergenic
905656060 1:39686792-39686814 CTGGGAAACCCAGACTCTGCAGG - Intronic
911742442 1:101401440-101401462 AGTGGAAGCCCAGACACAGCGGG - Intergenic
912261427 1:108114633-108114655 TTGGCAGACCCAGACATATCTGG + Intergenic
912856312 1:113171392-113171414 ATGGGAAAGCCAGCCTGAGCAGG - Intergenic
915643583 1:157250187-157250209 ATGGGAAACCAAGACATCGACGG + Intergenic
917423428 1:174888795-174888817 ATGGTAAAAACAGAAATAGCTGG - Intronic
920063160 1:203242614-203242636 AAGGGAAACCCAAAGATAACAGG + Intronic
921034078 1:211359682-211359704 ATGGGAAAGCCAGTCTTGGCTGG - Intronic
1063047242 10:2404726-2404748 ATGTTACTCCCAGACATAGCTGG - Intergenic
1063151175 10:3337768-3337790 TTGGGAAACCCAGCCACAGGTGG - Intergenic
1063453136 10:6164418-6164440 ATGTTTAACCCAGACATGGCAGG + Intronic
1067402225 10:45987503-45987525 GTGGGAAACCCTGACAAAGCTGG - Intronic
1067672366 10:48334612-48334634 CTGGGACACTCAGACAGAGCGGG + Intronic
1067870576 10:49957143-49957165 GTGGGAAACCCTGACAAAGCTGG - Intronic
1068720806 10:60243929-60243951 ATGGGAAGCTCAGGCAAAGCTGG + Intronic
1070363007 10:75708799-75708821 ATGGGAAAAGCAGACAAAACTGG - Intronic
1072748970 10:97962956-97962978 CTGAGAAACCCAGTCCTAGCTGG + Intronic
1073033137 10:100544012-100544034 TTGGCATACCCAGACAGAGCTGG + Intronic
1074014901 10:109524607-109524629 ATTGGAAACTCAGGCATTGCTGG + Intergenic
1075608889 10:123835931-123835953 ATGGGAAACTCAGCCAAAGGAGG + Intronic
1075640097 10:124058418-124058440 ATGGGAAACTGAGGCACAGCAGG + Intronic
1075915278 10:126161333-126161355 AGAGGAAACCAAGACACAGCAGG + Intronic
1080315182 11:30939254-30939276 CTGGGACACCCAGAGAGAGCGGG + Intronic
1081528235 11:43941726-43941748 ATGGGAAAACCAGGCACAGAGGG - Intronic
1082124780 11:48419384-48419406 ATGGGAATCCAGGAAATAGCTGG - Intergenic
1084020540 11:66414726-66414748 ATAGGAAACCCACGCAGAGCTGG - Intergenic
1085235760 11:75014103-75014125 CTTGGAAGCCCAGACCTAGCTGG + Intronic
1085261106 11:75205191-75205213 GTGGGACACCCAGACTTGGCAGG + Exonic
1087692319 11:101335752-101335774 AAGAGAAACCCAGAAATAGAAGG - Intergenic
1093253459 12:16837140-16837162 TTGGGAAACCCCGACCTTGCAGG + Intergenic
1093907858 12:24713610-24713632 ATGGAAAACTGAGACAGAGCGGG - Intergenic
1097156832 12:57018110-57018132 ATGGGTAAAGCAGGCATAGCTGG - Intronic
1097847057 12:64377564-64377586 ATGGGAAACCAAGAAATAAGAGG - Intronic
1100398323 12:94204305-94204327 GTGGGAAACTGAGGCATAGCTGG - Intronic
1101807467 12:108076779-108076801 ACGGGATTCTCAGACATAGCTGG + Intergenic
1102557957 12:113741279-113741301 ATGGGAAGCCCAGTCAGGGCTGG - Intergenic
1102913522 12:116736962-116736984 GGGGGAAACCAAGACATAGGTGG - Intronic
1103994151 12:124818184-124818206 ATGGTAAAGCCCCACATAGCTGG - Intronic
1104463106 12:128970750-128970772 ATGGGAACCCCAGTCACAGTGGG - Intronic
1106369008 13:29113246-29113268 AAGGGAAAGGCAGACAGAGCAGG - Intronic
1108063475 13:46554180-46554202 TGGGGAAACCCAGACAAAGGTGG + Intronic
1108726782 13:53191735-53191757 AAGGGAAACCCACACATGGTGGG + Intergenic
1109371529 13:61426726-61426748 ATGGTAAACACAGACCAAGCAGG + Exonic
1109392096 13:61706801-61706823 ATAGTAAACCCAGGCATATCTGG - Intergenic
1110593393 13:77291323-77291345 ATGGGAAACCCCTACTTAGTAGG + Intronic
1113611956 13:111653055-111653077 AGGGGAAACCCAGGCAGAGCTGG - Intronic
1114648479 14:24268716-24268738 CTGGGATACCCAGACATGGCTGG + Exonic
1114859533 14:26497851-26497873 ATATCAAACCCAGACATACCAGG + Intronic
1116580798 14:46638526-46638548 ATGGGAATCTCATACATTGCTGG + Intergenic
1116831263 14:49722104-49722126 AAAGGAAACCCAGCCATAGACGG - Intronic
1118508275 14:66440969-66440991 AAGGGAAACCCACACAGAGACGG - Intergenic
1121338736 14:93092698-93092720 GTGGGGAACCCAGCCAAAGCTGG + Intronic
1122063111 14:99150146-99150168 ATGGGAAAGGCAGACTTGGCAGG - Intergenic
1122376590 14:101264634-101264656 ATGGGGAGCCCAGACAGAGCAGG - Intergenic
1130719982 15:86377019-86377041 ATGGGAAAGCCAGATAGAGTGGG + Intronic
1130902060 15:88214775-88214797 ATGGTAAATTCAGACAAAGCTGG - Intronic
1132275896 15:100563716-100563738 TGGGGAACACCAGACATAGCTGG - Intronic
1134037217 16:11040170-11040192 TTGGGCCACCCAGACATAGCGGG - Intronic
1134235586 16:12462999-12463021 CTGGGAAACTCAGAAATAGCTGG - Intronic
1134424016 16:14121941-14121963 ATGGTACACTCAGAGATAGCCGG + Intronic
1138352008 16:56351069-56351091 CTGGGAGACCCTCACATAGCTGG + Intronic
1139935108 16:70564850-70564872 AAGGGAAATCCAGACATTGCTGG - Intronic
1141897314 16:86966320-86966342 ATGTGAGACCCAGACACACCAGG - Intergenic
1146714909 17:35077523-35077545 AAGGGAAACCCTTACAAAGCTGG + Intronic
1148126387 17:45239422-45239444 ATGGGGAACCCAGAGATACAGGG + Intronic
1151355632 17:73556442-73556464 ATGGGCTGCCCAGACATACCTGG - Intronic
1151692835 17:75697429-75697451 AGGTGAAACCCAGATATGGCTGG - Intronic
1154346528 18:13547792-13547814 TTGGGGAGCCCAGACATAGGAGG - Intronic
1155524916 18:26706276-26706298 ATGGGGAACTGAAACATAGCAGG - Intergenic
1157141621 18:45113687-45113709 ATAGGAAGCCTAGAGATAGCAGG - Intergenic
1159864439 18:73687758-73687780 ATGAAAAACCCAGACAAGGCTGG + Intergenic
1162314481 19:9929737-9929759 ATCAGAAACCCACACATACCAGG + Intronic
1162654554 19:12118327-12118349 GTGGGACACCCAGAGAGAGCAGG + Intronic
1163585929 19:18163409-18163431 GAGGGAAACCGAGACATAGAGGG + Intronic
1168665796 19:58204049-58204071 ACGGGAAGCCCAGACAGACCAGG + Intronic
925486363 2:4336465-4336487 ATGGGAAATACAGACAGAGCAGG + Intergenic
926987675 2:18641355-18641377 ATGGGGAGCAGAGACATAGCAGG + Intergenic
930541386 2:52711319-52711341 ATTTGAAACCCTGACATTGCGGG - Intergenic
931137623 2:59421771-59421793 CTGGAAAAGCCAGACATAGGAGG + Intergenic
933282836 2:80351377-80351399 ATCTGCAACCCAGACACAGCAGG - Intronic
934736808 2:96693842-96693864 TTGAGAAGCCCAGACAGAGCTGG + Intergenic
942401741 2:175610138-175610160 ATGGGAAATCCAGTCAAAGCAGG - Intergenic
944484356 2:200189106-200189128 TTGGAAAACTCATACATAGCAGG + Intergenic
946162068 2:217841394-217841416 ATGGGAAACACAGAGAGTGCAGG + Intronic
947082917 2:226419063-226419085 ATGGTAAACCCAGGCATCCCAGG + Intergenic
1169224744 20:3848921-3848943 ATGGGAACCACAGAGATGGCAGG - Intronic
1169948307 20:11013384-11013406 ATGAGAAACCAAGACATAGATGG - Intergenic
1170772753 20:19348353-19348375 GTGGCAAACACAGTCATAGCTGG + Intronic
1174879479 20:54263256-54263278 AAGGGAAACACATACAAAGCTGG - Intergenic
1174943956 20:54964126-54964148 ATGGGAAACCAATAAAGAGCTGG + Intergenic
1175497704 20:59426157-59426179 ATGGGGTACCCAGGCATATCTGG - Intergenic
1175540740 20:59746173-59746195 AAGGGAAACCCAAACACAGCAGG - Intronic
1175809630 20:61851041-61851063 GTGGGAAACACATCCATAGCAGG + Intronic
1175975230 20:62707625-62707647 CTGGGCAACCCAGACATGGAGGG + Intergenic
1179910373 21:44444263-44444285 ATGGGAAACCAGGACATGCCTGG + Intergenic
1180032857 21:45224250-45224272 AGGGAAAAGCCAGACATACCGGG - Exonic
1182404339 22:30111521-30111543 ATGTGAAACCCAGATATGGAAGG + Intronic
1182964081 22:34505171-34505193 ATGGGTAACCCTGAGGTAGCAGG - Intergenic
1183334823 22:37240638-37240660 ATGGGAGACCCACAAAGAGCTGG + Intronic
1183380137 22:37486460-37486482 AAGGGAACCCCAGACAGAGGCGG + Intergenic
1185162919 22:49240325-49240347 TTGGGAAACCGAGATAAAGCAGG + Intergenic
949284959 3:2391418-2391440 ATGAGAAACCCAGAGAAAGATGG + Intronic
949555551 3:5149296-5149318 CTGGAATACCCAGACAGAGCAGG + Intronic
954317222 3:49807686-49807708 AGGGGAAACCCAGGCCTAGTAGG + Intronic
955353221 3:58209427-58209449 ATGGGAAACCCTGACATGCAAGG - Intronic
955828955 3:62980942-62980964 ATGGGAAACCCAGAGAGACTAGG - Intergenic
957745544 3:84336998-84337020 TTGGGAAACCCAGATATATAAGG - Intergenic
957966371 3:87326201-87326223 ATGGGAAACCAAAAAAGAGCAGG + Intergenic
965682497 3:171265936-171265958 CTGGGGTCCCCAGACATAGCCGG + Intronic
965940593 3:174175453-174175475 AATGGAAACCCAGAAAGAGCAGG - Intronic
969297681 4:6279393-6279415 ATGGGAAACCGAGGGATAGAGGG + Intronic
970578968 4:17456354-17456376 ATGGGAAACCAAAACATTGTTGG + Intergenic
972022758 4:34335740-34335762 GTGGGAGACTCAGGCATAGCGGG + Intergenic
974161488 4:58147051-58147073 ATGAGAAGCCCAGACCTAGCTGG + Intergenic
975367885 4:73549825-73549847 AGCGGAAACTCAGATATAGCAGG + Intergenic
977464845 4:97371185-97371207 ATGGGAAACCCTGAGGTAGCTGG + Intronic
982507641 4:156240216-156240238 ATGTGAAACCCAGGTATGGCAGG - Intergenic
985269334 4:188179223-188179245 AGGGGAAACTCAGGCATGGCAGG - Intergenic
985507641 5:292982-293004 ATGAGAAGCCCAGGCAGAGCAGG - Intronic
990777605 5:59320444-59320466 ATGAGAAACCCATACACAGGAGG + Intronic
992320516 5:75609023-75609045 ATGTGAAACTTAGCCATAGCTGG - Intergenic
995191088 5:109319775-109319797 ATGGGAAGTCCAGAGACAGCAGG + Intergenic
995827155 5:116313502-116313524 ATTGGAAACCAAAAAATAGCAGG - Intronic
996318967 5:122192586-122192608 AAAGAAAACCCATACATAGCTGG + Intergenic
997250056 5:132381759-132381781 ATGGCAAACACACACATACCTGG - Intronic
1000395731 5:160772835-160772857 ATTGCAAACCCAGAGATATCTGG - Intronic
1000942641 5:167381133-167381155 TTCGGAAACTGAGACATAGCAGG + Intronic
1003306039 6:4930418-4930440 ATGGGAAACCCAGACATAGCTGG - Intronic
1003432915 6:6056482-6056504 CTGGGAAACCCGGACAGAGGGGG + Intergenic
1003926521 6:10882474-10882496 ATGCGAAACCCTGACCAAGCTGG + Intronic
1003983675 6:11414423-11414445 ATAGGAAACACAAACATATCTGG - Intergenic
1004632661 6:17436758-17436780 ATGGGGACCCCTGACATAGATGG - Intronic
1006939507 6:37742586-37742608 ATGGGAAACCCAGCAAAGGCTGG - Intergenic
1012138622 6:95592022-95592044 ATTGGAAACCCAGAAGTAGGAGG - Intronic
1012500833 6:99886643-99886665 ATGGGAACCTCAGACCTAGCTGG + Intergenic
1013585250 6:111572531-111572553 ATGGGAAACTCAGACAAAGTGGG + Intronic
1013649798 6:112182946-112182968 AGGGGAATCCCAGACATAAGTGG + Intronic
1014605568 6:123469775-123469797 ATGGAAAACACAGACAGAGAAGG + Intronic
1015742496 6:136471866-136471888 ACAGGAAAGCCAGTCATAGCTGG - Intronic
1015885920 6:137918674-137918696 ATGAGAAACCCTGACATAATGGG - Intergenic
1016163502 6:140909415-140909437 ATTGGAAAACCACACATACCTGG + Intergenic
1019346417 7:533014-533036 ACTGTAACCCCAGACATAGCTGG + Intergenic
1021078730 7:16337314-16337336 ATGGAAAACCTAGACATATGTGG + Intronic
1027737095 7:81946168-81946190 ATGGAAAACCCACATATACCAGG - Intergenic
1028695930 7:93712125-93712147 ATGGGAAACATAAACAAAGCGGG + Intronic
1029153995 7:98502060-98502082 ATGGAGAAGCCAGACAGAGCTGG + Intergenic
1031268344 7:119611491-119611513 ATGGGAAGTCCAGAGATAGCTGG - Intergenic
1034978332 7:155460644-155460666 GTTGGAAACCCAGACAGAGATGG + Intronic
1039054499 8:33524654-33524676 AGGGGAAACTGATACATAGCTGG + Intergenic
1039409486 8:37340703-37340725 ATGGGATAACCAGACAGAGAAGG + Intergenic
1039933025 8:42012127-42012149 ATGAGATACTCATACATAGCTGG + Intronic
1042795215 8:72654756-72654778 ATGGGAAAGAAAGACAAAGCAGG + Intronic
1043048996 8:75361523-75361545 CTGGGACACCCAGACAGAGTGGG - Intergenic
1048945131 8:139439596-139439618 CTGGGAAATCCCCACATAGCTGG + Intergenic
1051413593 9:16815689-16815711 GTGGGAAGCACAGATATAGCAGG - Intronic
1057070205 9:92091018-92091040 ATAGGAAACCCAAACTTAGATGG - Intronic
1061852386 9:133423805-133423827 ATGGGATACCCAGACAGCGTCGG - Intronic
1187667816 X:21633661-21633683 ATGTTAAACACAGATATAGCTGG + Intronic
1188625327 X:32277107-32277129 AATGGAAACCCAAACATAGCTGG + Intronic
1190982351 X:55467545-55467567 ATGAGAAAGCCAGATATAGAGGG - Intergenic
1190986348 X:55505638-55505660 ATGAGAAAGCCAGATATAGAGGG + Intergenic
1192939084 X:75893767-75893789 CTGGGACATCCAGACAGAGCAGG + Intergenic
1194497230 X:94631920-94631942 ATGAGAAACATAGAAATAGCAGG + Intergenic
1194508063 X:94758019-94758041 ATGGGAAAAACAGGCATTGCTGG + Intergenic
1199454784 X:148016270-148016292 AATGGAAACCAAGACAGAGCAGG - Intronic
1199635055 X:149806216-149806238 ATAGGACACCCAGACACAGGAGG + Intergenic
1202202402 Y:22367257-22367279 AGGGGAGGCTCAGACATAGCGGG + Intronic