ID: 1003306040

View in Genome Browser
Species Human (GRCh38)
Location 6:4930436-4930458
Sequence CACAGTGCAGGTGCAGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 3, 2: 5, 3: 55, 4: 447}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003306040_1003306046 -9 Left 1003306040 6:4930436-4930458 CCCATCCCTGCACCTGCACTGTG 0: 1
1: 3
2: 5
3: 55
4: 447
Right 1003306046 6:4930450-4930472 TGCACTGTGGCAGCTGCTTTCGG No data
1003306040_1003306052 15 Left 1003306040 6:4930436-4930458 CCCATCCCTGCACCTGCACTGTG 0: 1
1: 3
2: 5
3: 55
4: 447
Right 1003306052 6:4930474-4930496 GGAAAGGCGGGTGGACTGTTAGG 0: 1
1: 0
2: 0
3: 14
4: 141
1003306040_1003306051 6 Left 1003306040 6:4930436-4930458 CCCATCCCTGCACCTGCACTGTG 0: 1
1: 3
2: 5
3: 55
4: 447
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306040_1003306048 -1 Left 1003306040 6:4930436-4930458 CCCATCCCTGCACCTGCACTGTG 0: 1
1: 3
2: 5
3: 55
4: 447
Right 1003306048 6:4930458-4930480 GGCAGCTGCTTTCGGTGGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1003306040_1003306047 -6 Left 1003306040 6:4930436-4930458 CCCATCCCTGCACCTGCACTGTG 0: 1
1: 3
2: 5
3: 55
4: 447
Right 1003306047 6:4930453-4930475 ACTGTGGCAGCTGCTTTCGGTGG 0: 1
1: 0
2: 2
3: 11
4: 174
1003306040_1003306049 2 Left 1003306040 6:4930436-4930458 CCCATCCCTGCACCTGCACTGTG 0: 1
1: 3
2: 5
3: 55
4: 447
Right 1003306049 6:4930461-4930483 AGCTGCTTTCGGTGGAAAGGCGG No data
1003306040_1003306050 3 Left 1003306040 6:4930436-4930458 CCCATCCCTGCACCTGCACTGTG 0: 1
1: 3
2: 5
3: 55
4: 447
Right 1003306050 6:4930462-4930484 GCTGCTTTCGGTGGAAAGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003306040 Original CRISPR CACAGTGCAGGTGCAGGGAT GGG (reversed) Intronic
900329037 1:2124783-2124805 CGCCGTGCATGTGCAGGGCTTGG + Intronic
900554451 1:3272791-3272813 CACAGGGCAGCTCCAGAGATGGG - Intronic
900656697 1:3762225-3762247 CACAGGGCGGGGGCAGGGAAAGG + Intronic
900939728 1:5790864-5790886 TACAATGCGGGTGCAGGCATTGG - Intergenic
901217222 1:7561544-7561566 CTCGTTGCAGGCGCAGGGATGGG + Intronic
904425637 1:30421166-30421188 CACAATGGAGGGGCAGAGATGGG - Intergenic
906463575 1:46056545-46056567 CACAGTGACGGTTCAGGAATAGG + Intronic
906691487 1:47795758-47795780 GAAAGTGGTGGTGCAGGGATGGG - Intronic
907158476 1:52355029-52355051 CAAAATGCAGGTGGAGAGATTGG - Intronic
907523472 1:55040041-55040063 CAAGGTGCGGGTGTAGGGATGGG + Exonic
911580715 1:99630344-99630366 CCCAGTGGAGGTGGAGAGATTGG - Intergenic
911731407 1:101295861-101295883 CACAGGGCAGGTGTGGCGATTGG + Intergenic
913068761 1:115281421-115281443 CACAAGGTAGGTGCGGGGATAGG + Intergenic
914843934 1:151270135-151270157 CAGGGTGAAGGTGCAGGGAAGGG - Intergenic
914933383 1:151955301-151955323 CAAAGTGCAGGTACAGGCATGGG - Intergenic
915040252 1:152962356-152962378 CACAGTCCAGGTAGAGGGAATGG + Intergenic
915636141 1:157188192-157188214 CAAAGTGGAGGTACAGGGAAAGG - Intergenic
915643826 1:157252530-157252552 CACAGCCAAGGTCCAGGGATTGG + Intergenic
917779212 1:178373769-178373791 CAGAGGACAGGAGCAGGGATGGG - Intronic
918043866 1:180929391-180929413 CTCAGTGCAGGGTCAGGCATTGG + Intronic
919371848 1:196738455-196738477 CACAATGGGGGTACAGGGATTGG + Intronic
919896457 1:202012478-202012500 CTCTGTGGAGGGGCAGGGATGGG - Intronic
920025221 1:202989056-202989078 CACAGGGCAGGTGTGGGGAGTGG - Intergenic
920684038 1:208095577-208095599 CACAGAGGAGGAGCAGGGAAGGG - Intronic
921710768 1:218370955-218370977 CACAGTGTAGGTGGAGGAGTTGG + Intronic
922002068 1:221489199-221489221 CACAAGGCAGTGGCAGGGATGGG - Intergenic
923243930 1:232112586-232112608 AAAATTGAAGGTGCAGGGATGGG + Intergenic
923246603 1:232138275-232138297 CACTGAGCAGGGGCGGGGATTGG + Intergenic
923848904 1:237770850-237770872 CACAGAGTAGTTGCAGGAATCGG - Exonic
924017676 1:239744940-239744962 GACAGTGCAGGCGAAGGGACTGG + Intronic
924552278 1:245089818-245089840 CACAGAGAAGGTGAAGGGAGGGG + Intronic
1065130368 10:22613784-22613806 CAGGGTGCAGGTGCAGAGACAGG + Intronic
1065782752 10:29186050-29186072 CTCAGTCCAAGGGCAGGGATAGG - Intergenic
1067176932 10:43956715-43956737 CACCCTGTAGCTGCAGGGATTGG - Intergenic
1067663148 10:48251368-48251390 CCCAGTGCAGCTCCAAGGATAGG + Intronic
1068352266 10:55862670-55862692 TACAGTGGGGGTGCAGGCATTGG - Intergenic
1069829067 10:71271658-71271680 CCCAGGGCAGGTGCAGTGCTGGG - Intronic
1069919469 10:71807758-71807780 TACACTGCAGGTGCAGGGACTGG + Exonic
1069938196 10:71934090-71934112 CTCTGTGCAGGTGCAGAGAAAGG + Intergenic
1070027421 10:72645407-72645429 CACAGTGGGGGAGGAGGGATTGG + Intergenic
1070441785 10:76453386-76453408 CACAGTAGAGGTGAAGGGCTTGG - Intronic
1070864910 10:79702490-79702512 CACACTGCAGGGGCAGGGGCAGG - Intergenic
1070878699 10:79840622-79840644 CACACTGCAGGGGCAGGGGCAGG - Intergenic
1071368097 10:84922063-84922085 TAAAGAGCAGGTGCAGGGAATGG + Intergenic
1071631804 10:87224711-87224733 CACACTGCAGGGGCAGGGGCAGG - Intergenic
1071645258 10:87356932-87356954 CACACTGCAGGGGCAGGGGCAGG - Intergenic
1072124410 10:92432775-92432797 CTCATAGCAAGTGCAGGGATAGG + Intergenic
1072966502 10:99978128-99978150 CTCAGTGGTGGTGCTGGGATTGG - Intronic
1073179583 10:101575573-101575595 CACAGGGCAGGTGTGGGCATGGG - Intronic
1073284686 10:102380569-102380591 CACAGTGCAGATGCACGGGGAGG + Exonic
1074243302 10:111661421-111661443 AACTGTGCAGATGCAGGGACAGG - Intergenic
1075385645 10:122053523-122053545 CACAGGGAAGGTGCTGGGGTTGG - Intronic
1075729380 10:124627263-124627285 CACAGGGCAGCTGCAGGGCCTGG - Intronic
1076900595 10:133335740-133335762 GACAGCGCAGGTGCAGGGAGGGG - Intronic
1078388799 11:10917278-10917300 CACAATGGTGGTGCAGGCATTGG + Intergenic
1078515150 11:12015686-12015708 TACAGTGGAGGTACAGGCATTGG + Intergenic
1078518606 11:12046011-12046033 CACAGGGCTGGTGCAAGGAAAGG + Intergenic
1078590738 11:12638547-12638569 CACAGTACAGTTGAAGGGGTTGG - Intergenic
1081630361 11:44685356-44685378 CACAGTCCAGGTTTAGGGATAGG - Intergenic
1081863909 11:46349106-46349128 CAGAGTGCAGGTGCAAAGAGTGG - Intronic
1083249231 11:61454631-61454653 CACAGTGGTGGAGCAGGGACAGG - Intronic
1083336866 11:61927400-61927422 CACAGGTCAGGTACAAGGATAGG + Intergenic
1083735656 11:64679010-64679032 CTAATTGCAGGTGCAGTGATGGG + Intronic
1084402881 11:68955540-68955562 CACAGTGCAGGTGCAGGACTCGG - Intergenic
1084427645 11:69094326-69094348 CCCAGTGCAGGTGGCTGGATGGG + Intergenic
1084584604 11:70050351-70050373 CACAGTACAGGTGCAGGCCACGG + Intergenic
1084936848 11:72591347-72591369 CACAGTGCACCTGGAGGGATGGG + Exonic
1085032912 11:73283481-73283503 CCCAGGGCTGGTGCAGGGCTAGG - Intronic
1085306134 11:75487108-75487130 CACAGGGCAGGGCCGGGGATAGG - Intronic
1089209177 11:116789122-116789144 AACAGTGCAGGTGCAGAGGAAGG + Intergenic
1089335026 11:117717256-117717278 GGCAGTGCAGGTGCAGGGAGGGG - Intronic
1089391457 11:118104713-118104735 CACACTGCAGGTGCTGGACTCGG + Exonic
1089638653 11:119832726-119832748 CAGACTGGAGGAGCAGGGATGGG + Intergenic
1089661700 11:119990316-119990338 CACCCTGCAGCTCCAGGGATGGG - Intergenic
1089676197 11:120091518-120091540 CACAGAGCAGGTTCAGGGACAGG - Intergenic
1089801738 11:121036369-121036391 CAGAGTGAGGGTGGAGGGATGGG + Intronic
1091582742 12:1798984-1799006 CACAGTGGAGATGAAGAGATGGG + Intronic
1092098550 12:5864000-5864022 TAAAGAGCAAGTGCAGGGATAGG + Intronic
1092943264 12:13429856-13429878 AAGTGTGGAGGTGCAGGGATGGG - Intergenic
1093299707 12:17439288-17439310 CACAGTGGAGGTACAGGCATTGG + Intergenic
1095640793 12:44483114-44483136 CACAATGCAGGTACAGGCCTTGG + Intergenic
1095907006 12:47388954-47388976 CAAGGTGTAGGTGCTGGGATCGG - Intergenic
1096134584 12:49188789-49188811 CGCAGTGCGGGTGCAGGAACCGG - Intronic
1096163769 12:49403225-49403247 GGCAGTGCAGGTGTAGGGAAAGG + Intronic
1096523491 12:52197271-52197293 CACTCAGCAGGTGCAGGGAAAGG - Intergenic
1096956324 12:55529791-55529813 CTCAGTGCAGTTGTGGGGATTGG + Intergenic
1097059146 12:56269530-56269552 CACAGTGCAGGTTCGAGGATAGG - Exonic
1097302671 12:58035299-58035321 CACAGTGTGGGTACAGGCATTGG + Intergenic
1099233666 12:80056632-80056654 CAAAGCACAGGTGGAGGGATTGG - Intergenic
1100164539 12:91901399-91901421 TACAGTGAAGGTGCAGGCATTGG - Intergenic
1101738544 12:107482066-107482088 CACAATGCCTGTGCAGGGAGTGG + Intronic
1102021763 12:109688184-109688206 CAAGGAGGAGGTGCAGGGATTGG + Intergenic
1103727252 12:123004253-123004275 GACAGTGCAGGTATAGGGACTGG + Intronic
1104777181 12:131397259-131397281 TACAATGCAGGTACAGGCATAGG + Intergenic
1105411408 13:20174589-20174611 CACCGTGCAGGTGCGAGGGTGGG - Intergenic
1107097256 13:36550079-36550101 CTCAGTGCAGCCACAGGGATCGG - Intergenic
1108107278 13:47024786-47024808 CACAGAGAGGGAGCAGGGATAGG - Intergenic
1108981735 13:56523189-56523211 TACAATGCAGGTACAGGCATTGG + Intergenic
1109388537 13:61665192-61665214 GAGAGTGCAGCTGCAGGCATGGG - Intergenic
1110496419 13:76173677-76173699 TACAATGCAGGTGCAGGCATTGG + Intergenic
1110810737 13:79808410-79808432 CACATTGCAGGAGAAGAGATGGG + Intergenic
1111239752 13:85458234-85458256 CACAATGGAGGTACAGGCATGGG - Intergenic
1111594206 13:90389974-90389996 CACAATGAAGGTACAGGCATCGG - Intergenic
1111629017 13:90826225-90826247 TACAATGCAGGTACAGGAATTGG + Intergenic
1111641989 13:90980514-90980536 TACAGTGCAGGTACAGGCATTGG - Intergenic
1112023159 13:95389699-95389721 CACAGTGGAGGGGCAGGAATGGG + Intergenic
1112452050 13:99521587-99521609 CACAGTGTAGGTGCAGGTGCTGG - Intronic
1112855745 13:103767949-103767971 TACAATGCAGGTACAGGCATTGG + Intergenic
1113337504 13:109391281-109391303 TAAAGTGCAGGTGGAGGGAACGG - Intergenic
1113475010 13:110574330-110574352 CACACTGGAGGTGCCGGGAGCGG + Intergenic
1113666666 13:112146583-112146605 CTTAGTGCAGGTGCAGGGAAAGG - Intergenic
1114065322 14:19054766-19054788 CACAGTGCAAGCGCTGGGATGGG + Intergenic
1114096940 14:19345236-19345258 CACAGTGCAAGCGCTGGGATGGG - Intergenic
1115085703 14:29512763-29512785 TACAGTGGAGGTGCAGGCATTGG + Intergenic
1116071194 14:40047605-40047627 TACAATGGAGGTACAGGGATTGG + Intergenic
1116504072 14:45656455-45656477 GACTGTGCATGTGCAGGGAAGGG - Intergenic
1117525961 14:56604718-56604740 CACTGTTCAGGTTCAGGTATAGG + Intronic
1117647811 14:57870733-57870755 GACAGAGCAGGGGCAGGGCTAGG - Intronic
1117679305 14:58186938-58186960 CAGAGCTCAAGTGCAGGGATTGG + Intronic
1118046416 14:61975996-61976018 TACAATGCAGGTACAGGCATTGG + Intergenic
1118632097 14:67714814-67714836 CACAGTGCAGGTGTAAGGCCTGG - Intronic
1120108393 14:80523105-80523127 CACACTGCTGGTGTAGGGAAGGG - Intronic
1120332759 14:83114883-83114905 CACAATGCAGATGCAGGTAAAGG - Intergenic
1120844751 14:89115993-89116015 CACAGTGATGGTTCAGGGATGGG - Intergenic
1121309299 14:92926575-92926597 CACAGTGCAGGGGCAGGTTGGGG - Intronic
1121555132 14:94830667-94830689 CAGAGTTCAGGAGCAGGGAGTGG - Intergenic
1121958529 14:98237171-98237193 CACAGCTCAGCTGAAGGGATAGG - Intergenic
1123033505 14:105462138-105462160 CCCTGTCCAGGTGCGGGGATGGG + Intronic
1123491296 15:20784376-20784398 CACAGTGCAGGCGCTGGGATGGG - Intergenic
1123547798 15:21353467-21353489 CACAGTGCAGGCGCTGGGATGGG - Intergenic
1124131040 15:26985912-26985934 CACAGTGTAGGTGAAGGAAGTGG + Intronic
1125080820 15:35670803-35670825 CAGAGTGAAGGTGCAGGGTACGG - Intergenic
1125334666 15:38615595-38615617 CACAGTGCTGCTGCAGCAATAGG - Intergenic
1128113052 15:65088499-65088521 CACAGTGAAGGCGGAGGGACGGG - Intergenic
1128357150 15:66936188-66936210 CAGAGTCCAGCTGCAGGGCTGGG + Intergenic
1128610797 15:69071572-69071594 CAGAGTGAAGTGGCAGGGATGGG + Intergenic
1128660797 15:69499627-69499649 CAGAGTGCAGGGGCAAGGAAGGG - Intergenic
1129150149 15:73683655-73683677 CCAAGAACAGGTGCAGGGATGGG + Intergenic
1129197950 15:73982287-73982309 CACAGTGTGGCTGCGGGGATTGG + Exonic
1129242927 15:74262170-74262192 CTCAGGGCAGGGGTAGGGATGGG - Intronic
1129692568 15:77722040-77722062 CACCCTGCAGGTGCAGAGAGGGG - Intronic
1129851387 15:78795813-78795835 CACAGGGCAGGAGCAGGGAGTGG + Intronic
1130430807 15:83845059-83845081 CATGGTCCAGGTTCAGGGATGGG - Intronic
1130601367 15:85276712-85276734 TATAGTGCCGGTGCAGGTATGGG - Intergenic
1131144069 15:90000522-90000544 CTCAGGGCAGCTGCTGGGATCGG - Intergenic
1202956128 15_KI270727v1_random:80697-80719 CACAGTGCAGGCGCTGGGATGGG - Intergenic
1132959675 16:2614829-2614851 CTCAGAGCAGGGGCAGGGCTGGG - Intergenic
1132972735 16:2696804-2696826 CTCAGAGCAGGGGCAGGGCTGGG - Intronic
1133857648 16:9564727-9564749 TCCAGTGCAGATGGAGGGATGGG + Intergenic
1135266475 16:21030765-21030787 CACAGCTCAGTTGCAGGGCTAGG + Intronic
1136297456 16:29311827-29311849 CACTGTGCAGAGGCAGGGACTGG + Intergenic
1136744050 16:32567635-32567657 CACAATGCAGTTTCAGAGATAGG - Intergenic
1138392397 16:56679671-56679693 CACAGTGAATGTGAAGGGTTTGG + Intronic
1138537272 16:57666758-57666780 CAGAGGGCAGGTGCAGGGGAAGG - Intergenic
1139477012 16:67207816-67207838 CACGGTGCAGGGGCTGGGCTGGG - Intronic
1141805836 16:86340912-86340934 CACTCTGCAGGTGCTGAGATGGG - Intergenic
1141826581 16:86484937-86484959 CTCAGTGCAGCTGCAGGGCATGG + Intergenic
1141857570 16:86694355-86694377 CACAGTGCTGGTGAAGGCAGAGG - Intergenic
1142106349 16:88305069-88305091 CACAGAGCAAATGCAGTGATGGG + Intergenic
1142108624 16:88319382-88319404 CACACAGGAGGTGCAAGGATTGG + Intergenic
1142281099 16:89147960-89147982 TACAGTGGGGGTGCAGGCATTGG + Intronic
1142307678 16:89294717-89294739 GACAGTGCAGGTACAGGTACGGG - Intronic
1142376337 16:89708854-89708876 CACATGGCAGCTGCAGCGATGGG + Exonic
1203025548 16_KI270728v1_random:507598-507620 CACAATGCAGTTTCAGAGATAGG + Intergenic
1203046173 16_KI270728v1_random:826833-826855 CACAATGCAGTTTCAGAGATAGG - Intergenic
1142644028 17:1300668-1300690 CACAGAGCAGGAGAAGGGCTTGG + Exonic
1143181608 17:4987354-4987376 GACAGTGCAGGTGCCGGGTGCGG + Intronic
1143274832 17:5702697-5702719 CAGAGTGAAGCTGCTGGGATGGG + Intergenic
1144852021 17:18248648-18248670 CACACTGCTGGTGCAGGGCCAGG - Exonic
1145252811 17:21305626-21305648 CGAAGTCCAGGTGTAGGGATGGG + Intronic
1145279840 17:21458879-21458901 CTCAGTGCAGCTGCAGGGTGTGG - Intergenic
1145416270 17:22716091-22716113 CACTGTGCAGGGGGTGGGATGGG + Intergenic
1146545028 17:33730995-33731017 TGCAGTGTAGGTGCAGGGAGAGG - Intronic
1147359914 17:39923983-39924005 CACAGGGCAGGGGCAGGGGCAGG + Intronic
1147758855 17:42784819-42784841 CACAGGGCAGCTGGAAGGATTGG - Intronic
1148112210 17:45151599-45151621 CACAGGGCAGGTGAAGGACTGGG - Exonic
1149029584 17:52067868-52067890 TACAATGCAGGTACAGGCATTGG - Intronic
1149612571 17:57968293-57968315 CCCAGGGCAGGTGCATGGAGAGG + Intergenic
1150313298 17:64147003-64147025 CACAGTCCAGATTCAGTGATTGG + Intergenic
1151045537 17:70916190-70916212 CACACTGCAGGTGCAGGAGCAGG - Intergenic
1152532104 17:80924684-80924706 CTCAGGGCAGGTGCAGTGAGAGG - Intronic
1152648316 17:81480582-81480604 CACAGAGCAGGGGCTGGCATGGG - Intergenic
1152699971 17:81813848-81813870 GACAAGGCAGGTGCAGGGAGAGG - Exonic
1152961081 18:80460-80482 CAGAGTGCAGGAGGAGGGAAGGG + Intergenic
1153001953 18:463932-463954 TAGGGTGCAGGTGCAGGGAATGG - Intronic
1153822931 18:8847788-8847810 CACTGTGCAGGGGCTGGGATAGG - Intergenic
1154494829 18:14947967-14947989 CACATTGCAGGAGAAGGGAAAGG - Intergenic
1155559439 18:27060195-27060217 CACAGTCAAGGTTCAGGGAGGGG + Intronic
1157174724 18:45441032-45441054 CACAGTTCAGCTCCAGAGATTGG - Intronic
1157439632 18:47700705-47700727 CACAGTGGTTGTCCAGGGATGGG - Intergenic
1158300197 18:56043516-56043538 CACAGTGCAGGTGGGAGAATTGG - Intergenic
1160131009 18:76224806-76224828 CACAGTGGAGGGGCTGGGACAGG + Intergenic
1160554875 18:79718445-79718467 CACAGAGCAGATGCAGGGGTTGG + Intronic
1160670030 19:357480-357502 CACAGTGTAGGTGCAGGCACAGG + Intergenic
1160670040 19:357550-357572 CACAGTGTAGGTGCAGGCACAGG + Intergenic
1160670050 19:357634-357656 CACAGTGTAGGTGCAGGCACAGG + Intergenic
1161056801 19:2194824-2194846 CACAGAGGTGGTGCAGGGAATGG + Intronic
1161589532 19:5123042-5123064 GACTGTGCAGATGCAGGGACAGG + Intronic
1161869033 19:6856328-6856350 CACATTGCAGTTGCAGGGAGGGG + Intronic
1161896674 19:7087248-7087270 CACAGTGCAGGGGCTGGGCGTGG + Intronic
1162562486 19:11425766-11425788 CTCAGGGCAGGTGCAGGGGCGGG + Intronic
1163101311 19:15098760-15098782 CAAAATGCAGGTGGAGGGACCGG - Intergenic
1163196306 19:15723459-15723481 CACAGTGCAGAGACAGGGAGAGG + Intergenic
1163998741 19:21077497-21077519 TACAATGCATGTGCAGGCATTGG - Intergenic
1164635362 19:29787579-29787601 CACAGGGTGGGTGCAGGGGTGGG + Intergenic
1165505485 19:36225726-36225748 CACAAAGCAGGGGCAGGGCTTGG - Intronic
1165642671 19:37403343-37403365 CCCTGTGCAGGGGCAGCGATTGG + Intergenic
1165937999 19:39401162-39401184 CACAATGAGGGAGCAGGGATAGG + Intergenic
1166263787 19:41663690-41663712 TACAGTGGAGGTACAGGCATTGG + Intronic
1166736049 19:45085612-45085634 CACAGTTCAGGTGCAGAGACAGG + Intronic
1166819497 19:45568776-45568798 CACAGAGACGGTGCTGGGATGGG + Intronic
1166979636 19:46624946-46624968 CACAGAGCAGGAGCAGGTAGAGG - Intronic
1167608004 19:50492132-50492154 CTCACTGAAGGTGCAGGGAGAGG + Intergenic
1167768229 19:51498219-51498241 CACAGACAAGGTGCAGGGACTGG + Exonic
1168686359 19:58351717-58351739 CAGAGGGCAGCTCCAGGGATGGG - Intronic
1168723927 19:58570503-58570525 CACAGTCCAGGTGCAGGGCCAGG - Exonic
925064790 2:921593-921615 CACAGCAGAGGGGCAGGGATGGG - Intergenic
925379675 2:3416559-3416581 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379692 2:3416606-3416628 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379700 2:3416629-3416651 CACAGTGAAGGGGCAGGGGAGGG - Intronic
925379709 2:3416653-3416675 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379734 2:3416723-3416745 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379752 2:3416769-3416791 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379761 2:3416793-3416815 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379779 2:3416839-3416861 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379788 2:3416863-3416885 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379797 2:3416887-3416909 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925379806 2:3416911-3416933 CACAGTGAAGGGGCAGGGGGAGG - Intronic
925409546 2:3631981-3632003 CACAGTGGGGGTGCAGGGTTTGG + Intronic
926058555 2:9790859-9790881 CGGAGTGCAGGTGCAGGGAGCGG - Intergenic
926500302 2:13644543-13644565 TACAGTGGAGGTGAAGGCATTGG - Intergenic
927146991 2:20172617-20172639 CACAGTGATGGTGCAGGCAGGGG + Intergenic
927293232 2:21424622-21424644 CACACTGCAGGGACAGGGAAAGG + Intergenic
927498646 2:23567020-23567042 CACAGTGGTGGGCCAGGGATGGG - Intronic
927917730 2:26947522-26947544 CCCTGTGTAGGGGCAGGGATGGG + Exonic
928555805 2:32423680-32423702 CACAGATAAGGGGCAGGGATTGG - Intronic
930280340 2:49362172-49362194 CACAATGGAGGTACAGGTATTGG + Intergenic
930507829 2:52305903-52305925 TACAATGGAGGTGCAGGCATTGG - Intergenic
930752994 2:54949992-54950014 CACTGTGCAGGTGGAAGGATGGG - Intronic
931463414 2:62467211-62467233 CAAGGGGCAGGTGCAGGGGTGGG - Intergenic
932306116 2:70705292-70705314 CACAGAGCAGCTCCAGGGAATGG - Intronic
933703462 2:85272868-85272890 CACAGGGCAGGAGCGGGGAGAGG + Intronic
934120903 2:88838484-88838506 GATAGAGCAGGTGCAGGGCTAGG + Intergenic
934571125 2:95374051-95374073 CACACTGCAGGGGCTGCGATGGG + Intronic
934606702 2:95700627-95700649 CACAGTGCAGGACCTGGGACAGG - Intergenic
934773022 2:96919996-96920018 AACAGTGCAGGGGAAGGGAAGGG + Intronic
935053112 2:99540867-99540889 CGCAGTGCAGTTCCTGGGATGGG - Intergenic
935104944 2:100032788-100032810 CACAGTGTTGATGCAGGGATAGG - Intronic
935582908 2:104774269-104774291 CTCAGTGCTGGTGTAGGGGTTGG + Intergenic
936076399 2:109404452-109404474 CACTCTGCAGGGGCAGGGACAGG + Intronic
936540100 2:113342760-113342782 CACAGTGCAGGACCTGGGAGAGG - Intergenic
936701064 2:115012166-115012188 CACAGGGTAGGGGCAGGGATAGG - Intronic
937777031 2:125790083-125790105 TACAGTGCTGGTACAAGGATAGG + Intergenic
938482580 2:131673768-131673790 CACAGTGCAGGCGCTGGGATGGG + Intergenic
938928248 2:136063845-136063867 CACAGAGCAGGAGAAGGGATAGG - Intergenic
941738338 2:169005309-169005331 CACCATGTAGGGGCAGGGATAGG + Intronic
942784916 2:179689643-179689665 CACAGTGCAGGGTGAGGAATGGG - Intronic
942919663 2:181356382-181356404 AACAGTGTGGGTTCAGGGATGGG - Intergenic
943417872 2:187630974-187630996 TACAGTGGGGGTACAGGGATTGG - Intergenic
943423406 2:187698288-187698310 TACAGTGGAGGTACAGGCATTGG - Intergenic
944048220 2:195437902-195437924 CACAGCAGAGGAGCAGGGATTGG + Intergenic
946870654 2:224081650-224081672 AACAGCTGAGGTGCAGGGATAGG + Intergenic
947327183 2:228991900-228991922 CACATTGCAGGTGAAGAGAAGGG - Intronic
947629775 2:231644641-231644663 CGCAGAGCATGTGCAGGGCTGGG - Intergenic
948422875 2:237871268-237871290 GACAGAGCAGGGGCAGGGAGAGG + Intronic
948686057 2:239670368-239670390 CACAGGCCAGGAGCAGGGTTGGG - Intergenic
948869714 2:240791917-240791939 CCCAGTGCAGGGCCTGGGATGGG - Intronic
1168851347 20:979171-979193 AACAGGGCAGGAGCAGGGAACGG - Intronic
1169598525 20:7229092-7229114 CACACTGCAAGTGCTGGGAAAGG + Intergenic
1170037604 20:12005248-12005270 CACAATGCGGGTACAGGGATTGG - Intergenic
1170580624 20:17697063-17697085 CACAGTGCAGGTGTGAGGCTGGG + Intronic
1170845759 20:19960741-19960763 CACAGGGCAGGCGGAGGGAGAGG - Exonic
1171189534 20:23149437-23149459 CACGGTGTAGGTGCAGGGAAGGG - Intergenic
1171519574 20:25765489-25765511 CACTGTGCAGGGGGTGGGATGGG + Intronic
1171557346 20:26091004-26091026 CACTGTGCAGGGGGTGGGATGGG - Intergenic
1173392223 20:42645469-42645491 CACAGTGAAGGCTCAGGGAAGGG - Intronic
1173906439 20:46633198-46633220 CACAGAGCAGGCCCAGGGAAAGG + Intronic
1174361501 20:50031641-50031663 CATAATGCAGGTGCATGGATGGG - Intergenic
1174499816 20:50976241-50976263 CCCAGTCCAGATCCAGGGATGGG - Intergenic
1175140605 20:56858182-56858204 CACAGAGCATGTGCAGGAACAGG - Intergenic
1175203072 20:57291200-57291222 CCCCCTGCAGGTGCAGGGAGCGG + Intergenic
1175207884 20:57325847-57325869 GCCAGTGCAGCTGCAGTGATGGG + Intergenic
1175372214 20:58499664-58499686 CACAGAGCAGGAGCAGGTAGGGG - Intronic
1175912745 20:62412591-62412613 CATGGGGCAGGTGCAGGGAAGGG - Intronic
1175916780 20:62429671-62429693 CACAGTGCAGGTGCAGTGCCAGG - Intergenic
1176008129 20:62877195-62877217 CACAGCGCGGCTGCAGGGACAGG - Intergenic
1176447326 21:6831439-6831461 CACAGTGCAGGTGCTGGGATGGG + Intergenic
1176653716 21:9571766-9571788 CACTGTGCAGGGGGTGGGATGGG + Intergenic
1176825494 21:13696465-13696487 CACAGTGCAGGTGCTGGGATGGG + Intergenic
1177011998 21:15742030-15742052 CATAGTGCAGTTGCAGGGGTGGG + Intronic
1179301839 21:40118777-40118799 CACAGTGCAGGAGCGCGGACTGG - Intronic
1179427260 21:41291523-41291545 CCCAGTGAAGGTGCAAAGATTGG - Intergenic
1180030995 21:45207655-45207677 CACAGTGCAGGTGCACAGCAAGG - Intronic
1180483813 22:15777386-15777408 CACAGTGCAAGCGCTGGGATGGG + Intergenic
1180597443 22:16988005-16988027 CACCCCGGAGGTGCAGGGATGGG + Exonic
1181033896 22:20160874-20160896 CCCAGTGCAGGGCCAGGGAAGGG + Intergenic
1181363704 22:22357831-22357853 CACTGTGCAGGTGACAGGATGGG + Intergenic
1181366518 22:22380916-22380938 CACTGTGCAGGTGACAGGATGGG + Intergenic
1181372890 22:22432034-22432056 CACTGTGCAGGTGACAGGATGGG + Intergenic
1181602788 22:23961955-23961977 CACAGTGATGGTCCAGGGCTGGG + Intergenic
1181605726 22:23979352-23979374 CACAGTGATGGTCCAGGGCTGGG - Intronic
1182476965 22:30581668-30581690 AGCAGTGTGGGTGCAGGGATGGG + Intronic
1183004586 22:34890546-34890568 TACAATGCAGGTGTAGGCATTGG - Intergenic
1183545801 22:38454481-38454503 CAGGGCGCAGGGGCAGGGATTGG - Intronic
1183950469 22:41349699-41349721 CACAGAGCTGCTGCGGGGATTGG + Intronic
1184157709 22:42679257-42679279 CACAATGCAGGTACAGGCATTGG - Intergenic
1184296332 22:43527666-43527688 CCCTGTGCAGGGGCAGGGAAGGG + Intergenic
1184331143 22:43828712-43828734 CACAGAGCAGATCCAGGGACTGG - Intronic
1184490720 22:44807241-44807263 CAGAGTGCTGGTGGAGGGTTAGG + Intronic
1184491190 22:44810086-44810108 CACAGTGAGGCTGCAGGGAAGGG - Intronic
1184643054 22:45882392-45882414 CACAGTCCAGGTCCTGGGAGGGG + Intergenic
1184671386 22:46013801-46013823 CACCGTCCAGGTGCAGGGTGGGG + Intergenic
1185099111 22:48828210-48828232 GCCAGTGCAGGGGCAGGGAGAGG - Intronic
1203307382 22_KI270736v1_random:118786-118808 TACAATGCAGTTGCAGGGAATGG + Intergenic
949260284 3:2097875-2097897 CACAGTGCTGGTGAGGGGCTGGG + Intergenic
950178948 3:10897424-10897446 CACAATGGAGGTACAGGCATTGG + Intronic
950530207 3:13548856-13548878 CACAGGGCAGGGCCAGGGGTTGG - Intergenic
950589403 3:13925369-13925391 TACAATGCAGGTACAGGAATTGG - Intergenic
951192602 3:19787236-19787258 TACAATGCAGGTACAGGTATTGG - Intergenic
951262222 3:20523610-20523632 CACTGTGTGGGGGCAGGGATAGG + Intergenic
952939537 3:38431981-38432003 CACAATGGAGGTACAGGCATTGG + Intergenic
953627365 3:44581718-44581740 CCCAGTGAAGGTGCTGGGAGTGG + Intronic
953822921 3:46223825-46223847 CAGGGTGCTGGTGCAGGTATGGG + Intronic
954647805 3:52142216-52142238 CACATTACAGGTTCTGGGATGGG + Intronic
954671326 3:52292784-52292806 CACAGTACAGCTGCAGGGCTCGG + Exonic
954975091 3:54685952-54685974 TTCAGGGCAGGTGCAGGAATAGG - Intronic
955757322 3:62238639-62238661 AACAGAGCAGGTGCAGGGTGGGG - Intronic
958531893 3:95343365-95343387 GGCAGTGCAGGTGCAGTCATGGG - Intergenic
958588243 3:96118615-96118637 CACAGTGGGGGTACAGGTATTGG - Intergenic
958674686 3:97252608-97252630 CACAGGGCAGGGATAGGGATTGG + Intronic
958955067 3:100458289-100458311 CACAGTGGGGGTACAGGCATTGG + Intergenic
961145418 3:124588985-124589007 CACTGGGGAGGTGCAGGGATTGG + Intronic
961168892 3:124781812-124781834 CACAGTGGAGGGACAGGGATAGG - Intronic
962236337 3:133710646-133710668 CCAAGTGCAGGTAGAGGGATTGG - Intergenic
962942813 3:140141223-140141245 CAAAGTCCAGGTCCAGGGACTGG - Intronic
963615739 3:147535413-147535435 CACAGTGCCAGAGCAGGGGTTGG - Intergenic
964861486 3:161207203-161207225 TACAGTACACGTGCAGGAATAGG + Intronic
965045574 3:163572892-163572914 TACAATGCAGGTGCAGGCATTGG - Intergenic
966068159 3:175841549-175841571 CACAGTCCAGTTGGAGAGATAGG - Intergenic
966334642 3:178854503-178854525 CCCAGTGTAGGTAAAGGGATTGG + Intergenic
967171968 3:186828751-186828773 CACAGAGCAGGGGCGGGGGTGGG + Intergenic
967412424 3:189180434-189180456 CACAGTGGGGGTACAGGTATTGG + Intronic
967565123 3:190963223-190963245 TACAATGCGGGTCCAGGGATTGG - Intergenic
968387589 4:155612-155634 CACAATGGGGGTGCAGGCATTGG - Intronic
968392320 4:203715-203737 CACAGTGGGGGTACAGGCATTGG - Intergenic
969214461 4:5711133-5711155 CTCAGTGCAGGGGCAGGGCTGGG + Intergenic
969337061 4:6517239-6517261 CACAGGGCAGGTGCCGGGCAAGG - Intronic
969349571 4:6590675-6590697 CAGGCTGCAGGTGCAGGGATAGG + Intronic
969673314 4:8601594-8601616 GACAGTGACGGTGCAGGCATTGG + Intronic
972200047 4:36703270-36703292 CACAATGAAGGTACAGGTATTGG - Intergenic
974267844 4:59608434-59608456 CACTGTGCAGTTGCAGTGTTAGG + Intergenic
976701340 4:87971981-87972003 CACATTGGAGTTGAAGGGATGGG - Intergenic
977169963 4:93749955-93749977 AACAATGCAGGTGAAGAGATAGG + Intronic
977189219 4:93978389-93978411 TACAGTGGAGGTACAGGCATTGG - Intergenic
978251542 4:106637124-106637146 CACAATGCAGGCACAGGCATTGG - Intergenic
980916049 4:139034194-139034216 CACAGTGCTGTTCCAGGGGTGGG - Intronic
982398506 4:154940080-154940102 AACAGTGTAGGTGCAGGCAATGG - Intergenic
985363094 4:189196444-189196466 AACAGTTCATGTGCATGGATTGG - Intergenic
986736782 5:10674015-10674037 CACATTGCAGGCACAGGGAGGGG + Intergenic
986785105 5:11106908-11106930 CACAGTTCAGGAGCAGAAATGGG - Intronic
986987439 5:13515159-13515181 TACAATGCAGGTACAGGCATTGG - Intergenic
987265966 5:16255519-16255541 TACAATGCAGGTACAGGTATTGG - Intergenic
987991474 5:25217983-25218005 CACAATGTGGGTGCAGGCATTGG + Intergenic
988458197 5:31406900-31406922 CACAGTGTAGGTTCGGGCATGGG + Exonic
988628238 5:32900413-32900435 CACAATGCAGGCACAGGCATTGG + Intergenic
989537541 5:42581925-42581947 CTGGGTGCAGGTGCAGGGAGAGG - Intronic
990511335 5:56492102-56492124 CACACTGCAGGTGGAAGGAAAGG - Intergenic
993289150 5:86042108-86042130 GACAGTGTAGGTGAAGGGAAAGG - Intergenic
994755548 5:103789945-103789967 CACAGTGGGGGTACAGGCATTGG + Intergenic
995141581 5:108741224-108741246 CAGAGAGCTGCTGCAGGGATAGG - Intergenic
996177699 5:120379364-120379386 TACAATGGAGGTGCAGGCATTGG - Intergenic
996196431 5:120612150-120612172 AACAGTGGAGGTACAGGTATTGG - Intronic
996255965 5:121403203-121403225 TACAGTGGAGGTACAGGCATTGG - Intergenic
997662911 5:135603287-135603309 CAGGGTGCAGGTGCAGGGTTTGG - Intergenic
997791831 5:136768981-136769003 GACAGGGCAGGGGCAGGGATAGG + Intergenic
998040849 5:138950230-138950252 CACAGTTCAGGTTCTGGGACTGG - Intronic
998294254 5:140951934-140951956 TACAGTGCGGGTACAGGCATTGG + Intronic
998708944 5:144798875-144798897 CACATTCCAGGTGCAGGAAATGG + Intergenic
1000515918 5:162236368-162236390 CACAATGCGGGTACAGGCATTGG + Intergenic
1001758983 5:174192228-174192250 CAGAGTGTGGGTGCAGGAATAGG - Intronic
1002094128 5:176821137-176821159 CACAGGGCAGGGGCGGGGCTTGG - Intronic
1002197440 5:177509089-177509111 GACAGTGCCGCTGCAGGGAGGGG + Intronic
1002464657 5:179400895-179400917 CACAATGCAGGTACAGGCATTGG - Intergenic
1002932612 6:1644750-1644772 CACAGTACAGGTGCAAGAAACGG - Intronic
1003029482 6:2589532-2589554 CACAGTGGGGGTGGGGGGATGGG - Intergenic
1003030825 6:2599094-2599116 CACAGGGCAGGAGCAGTGAGGGG - Intergenic
1003306040 6:4930436-4930458 CACAGTGCAGGTGCAGGGATGGG - Intronic
1004830747 6:19474807-19474829 CACAGTGAGGGTCCAGGTATTGG + Intergenic
1005597709 6:27394964-27394986 TACAATGGAGGTGCAGGCATTGG - Intronic
1006417779 6:33914938-33914960 CACTGTGGAGGGGCAGGGAGAGG - Intergenic
1006441389 6:34055844-34055866 CACAGGGGAGGGGCAGTGATCGG - Intronic
1007211464 6:40196204-40196226 CACAGGGCAGAGGCAGGGAGAGG + Intergenic
1007474140 6:42107651-42107673 CCCAGGGCAGGGGCAGGGGTGGG + Intronic
1008052591 6:46915341-46915363 CACTGTGCAGGAGCAGGGCCTGG + Intronic
1008332657 6:50262017-50262039 CACAGTGGGGGTACAGGTATTGG + Intergenic
1009710304 6:67309145-67309167 CACAATGGAGGTACAGGTATTGG - Intergenic
1010451896 6:76013036-76013058 AGCAGTGCAGGAGTAGGGATAGG - Intronic
1010547094 6:77172495-77172517 CACAGTGTTAGTGCAGGGTTGGG + Intergenic
1010678178 6:78768353-78768375 TACAATGCAGGTACAGGCATTGG - Intergenic
1011805902 6:91072246-91072268 TACAGTGAAGGTACAGGCATTGG - Intergenic
1012485982 6:99722919-99722941 CACAATGGAGGTACAGGCATTGG - Intergenic
1012653312 6:101784342-101784364 TACAATGCAGGTACAGGCATTGG - Intronic
1012818146 6:104050732-104050754 CAGAGTGCATGTGCAGAGAGAGG + Intergenic
1013915941 6:115336842-115336864 TACAGTGAAGGTACAGGCATTGG - Intergenic
1015223810 6:130833737-130833759 CACAGAGCAAGTGCAAGTATTGG + Intronic
1015673863 6:135723172-135723194 CACAATGGGGGTGCAGGCATTGG - Intergenic
1015678873 6:135781582-135781604 CCCAGTGTTGGTGCAGGGGTGGG - Intergenic
1015899133 6:138046859-138046881 CACAGTGTGGGTACAGGCATTGG + Intergenic
1016048800 6:139507742-139507764 ATCAGTGCAGGTGAAAGGATAGG - Intergenic
1016648345 6:146435260-146435282 GACAGAGCAGGTGCGGGGAAGGG + Exonic
1016682252 6:146844748-146844770 TACAGTGAAGGTACAGGCATTGG + Intergenic
1017854754 6:158340539-158340561 CTCAATGCAGGTGCAGGGCCTGG - Intronic
1018028392 6:159822991-159823013 CTCAGAGGAGGGGCAGGGATCGG - Intergenic
1018205833 6:161436289-161436311 CAGAGAGCAGGGGCCGGGATGGG + Intronic
1018968996 6:168512317-168512339 CACAAGGCGGGTGCTGGGATGGG - Intronic
1019434306 7:1014024-1014046 CACAGCGTAGGTGCAGTGACAGG - Intronic
1019853592 7:3583044-3583066 CAGAGGGCAGGGGTAGGGATGGG + Intronic
1021456811 7:20838702-20838724 CACCGTGAAGGTACAGGGTTAGG - Intergenic
1022255989 7:28658523-28658545 CCCAGTGCAGCTGCAGGGACTGG - Intronic
1022346217 7:29517013-29517035 CACAGTGCTGGGTAAGGGATGGG - Intergenic
1023230869 7:38027596-38027618 CACTGTGGAGCTGCAGGGCTTGG + Intergenic
1023937732 7:44751201-44751223 CACAGGGCAGGTACAAGGAGGGG - Intronic
1023980690 7:45068392-45068414 CACAGTGGAAGGGCAGGCATGGG - Intronic
1024063369 7:45714819-45714841 CACAGTGCCGGTGCAGGATGGGG - Exonic
1024358303 7:48441581-48441603 AAAAGTGCAGTTGCAGGCATCGG - Intronic
1024879261 7:54067171-54067193 CCCAGTGCAGGTCCTGAGATAGG - Intergenic
1025061752 7:55814670-55814692 CACAGTTCATGTTCATGGATTGG + Intronic
1025280063 7:57620424-57620446 CACTGTGCAGGGGGTGGGATGGG + Intergenic
1025304672 7:57845077-57845099 CACTGTGCAGGGGGTGGGATGGG - Intergenic
1026746872 7:73020826-73020848 CACAGTGCAGGGGCTCAGATTGG - Intergenic
1026750524 7:73048969-73048991 CACAGTGCAGGGGCTCAGATTGG - Intergenic
1026754171 7:73077079-73077101 CACAGTGCAGGGGCTCAGATTGG - Intergenic
1026757822 7:73105112-73105134 CACAGTGCAGGGGCTCAGATTGG - Intergenic
1026929462 7:74215811-74215833 CCCAGTGCAGGAGCGGGGAGGGG + Intronic
1026930393 7:74220263-74220285 CACAGGGCAGGGACAGGGACAGG + Intronic
1026946748 7:74321053-74321075 CACACAGCAGGAGCAGGGCTAGG - Intronic
1027032976 7:74905397-74905419 CACAGTGCAGGGGCTCAGATTGG - Intergenic
1027089581 7:75288372-75288394 CACAGTGCAGGGGCTCAGATTGG + Intergenic
1027093226 7:75316300-75316322 CACAGTGCAGGGGCTCAGATTGG + Intergenic
1027096869 7:75344267-75344289 CACAGTGCAGGGGCTCAGATTGG + Intergenic
1027458688 7:78424827-78424849 TACAGTGGGGGTGCAGGCATTGG - Intronic
1027512120 7:79096084-79096106 CACAGTGCAGGGCCAGGAAAAGG - Intronic
1028803835 7:95000753-95000775 CACAGTTAAGTTGCAGGGTTAGG + Intronic
1029257074 7:99276682-99276704 CACAGTGCAGGAGGAGGGCAGGG + Intergenic
1029397979 7:100321243-100321265 CACAGTGCAGGGGCTCAGATTGG + Exonic
1030316836 7:108124809-108124831 GACTGTGCATGTGCAGGGACTGG - Intronic
1030379431 7:108795393-108795415 CACTGTGGAGGTGCATGGAAAGG + Intergenic
1030967147 7:116006531-116006553 TACAGTGAGGGTGCAGGCATTGG - Intronic
1032179115 7:129660477-129660499 TACAGTGGGGGTACAGGGATTGG + Intronic
1033257734 7:139816778-139816800 CAGGGAGCAGGGGCAGGGATGGG - Intronic
1034261989 7:149763032-149763054 GAGAGTGCAGGTGCAAGGACTGG - Intergenic
1035072549 7:156155991-156156013 CACGGTGCAGGTGTAGGCGTAGG + Intergenic
1035548005 8:498463-498485 CACAATGGAGGTGCAGGCGTTGG - Intronic
1035739051 8:1912501-1912523 CACGGTGCTTTTGCAGGGATGGG - Intronic
1035893527 8:3372271-3372293 TACAGTGGAGCTGCAGGGACAGG + Intronic
1036715908 8:11123855-11123877 CACAGTGCAGGTGCCAGGTGGGG - Intronic
1037728175 8:21501276-21501298 CACAGTGCTGGAGCAGGGAGGGG + Intergenic
1039216901 8:35281953-35281975 CCGAGTACATGTGCAGGGATAGG - Intronic
1040344808 8:46481255-46481277 CACAGAGCAGTTTCAGAGATAGG + Intergenic
1040457151 8:47610224-47610246 CAGATTGCAGCTGCAGGAATGGG - Intronic
1040668817 8:49661918-49661940 CACATTGCATGTTCATGGATAGG + Intergenic
1041984742 8:63908896-63908918 TACAGTGGGGGTACAGGGATTGG + Intergenic
1044234040 8:89809604-89809626 CACAATGGAGGTACAGGTATTGG - Intergenic
1045122962 8:99058646-99058668 CACAGTGGAGGGGAAGGGATTGG + Intronic
1045240532 8:100396726-100396748 CTCAGTGCATCTGCAGGGAGGGG - Intronic
1045664395 8:104469381-104469403 CACAGTGATGATACAGGGATGGG + Intergenic
1046060816 8:109137363-109137385 CACATTGCATGCTCAGGGATGGG - Intergenic
1048140559 8:131790173-131790195 CCCAGAGCAGGTGCAGGGCCTGG + Intergenic
1048487511 8:134862372-134862394 CACAGAGCAGGAGAAGGCATGGG - Intergenic
1048751524 8:137682074-137682096 CTAAGTGCAGGTGCAGTGATGGG - Intergenic
1049099471 8:140568792-140568814 GACAGAGCAGGTACAGGGAGTGG + Intronic
1049708605 8:144053858-144053880 CACTGAGCAGCTGCAGGGAAGGG - Intronic
1049770426 8:144377965-144377987 GAGAGTGCAGGGGCAGGGATGGG + Intronic
1049944212 9:579115-579137 CACACTGAAGCTGCAGGGATGGG + Intronic
1051309890 9:15758412-15758434 TACAGTGGAGGTACAGGCATTGG - Intronic
1051425703 9:16929633-16929655 GACAGTGCTGGTCCAGAGATAGG + Intergenic
1053036428 9:34830634-34830656 CCCAGTGATGGTGCTGGGATTGG + Intergenic
1053511130 9:38688424-38688446 CACAGTGCGGGGACAGGGAGAGG + Intergenic
1055433686 9:76270881-76270903 CACAGAACAGGTGCAGGTTTGGG - Intronic
1056430421 9:86522082-86522104 CAAAGTACAGCTGCTGGGATTGG - Intergenic
1057355856 9:94330893-94330915 CACACTGCAGGGGCAGGCAGTGG + Intergenic
1057390748 9:94639743-94639765 CACAGTGCGGGTGGAGGGCACGG - Intronic
1057651902 9:96926736-96926758 CACACTGCAGGGGCAGGCAGTGG - Intronic
1058637323 9:107049280-107049302 GACAGTGCAGGAGGAGGGAGAGG - Intergenic
1059361282 9:113743746-113743768 CAGTGTGCAGGTGCAGGGTGTGG + Intergenic
1060653483 9:125351542-125351564 TACAATGGAGGTGCAGGCATTGG + Intronic
1060795355 9:126509144-126509166 CACAGAGGAGGTGCAGGAACAGG - Intergenic
1061405969 9:130393293-130393315 CACCTTGCAGGTGCAGGGTATGG + Intronic
1061728342 9:132594005-132594027 CACAATGCAGGGGCAGGGCGGGG + Exonic
1061946272 9:133909908-133909930 CACAGGGCAAGGGCAGGGCTGGG + Intronic
1062199059 9:135291338-135291360 CGCCGTGCAGCTGCAGGTATAGG + Intergenic
1062217520 9:135397304-135397326 CACACTGCTGGCGCAGGGACAGG + Intergenic
1062730104 9:138103923-138103945 CACAATGCAGGGGCAGGGCAGGG - Intronic
1062737079 9:138143526-138143548 CAGAGTGCAGGAGGAGGGAAGGG - Intergenic
1203521864 Un_GL000213v1:53092-53114 CACAGTGCAGGTGCTGGGATGGG - Intergenic
1191141774 X:57121856-57121878 GACGGTGCAGGGGCAGGGGTGGG - Intergenic
1192358260 X:70423202-70423224 CACAGAGCAGCTGCAGGCCTTGG + Exonic
1192766651 X:74146762-74146784 GACAGTGGCGGTGCAGGGGTGGG - Intergenic
1193139865 X:78016596-78016618 TACAGTGGGGGTGCAGGCATTGG + Intronic
1193585758 X:83319156-83319178 CACAGTGGGGGTACAGGCATTGG - Intergenic
1194534181 X:95085581-95085603 TACAATGGAGGTACAGGGATTGG + Intergenic
1195035192 X:100965747-100965769 TACAGTGGAGGTACAGGCATTGG - Intergenic
1195136070 X:101908550-101908572 CAGGCTGCAGCTGCAGGGATGGG - Intronic
1196379948 X:115078391-115078413 CAGAATGCAGGTACAGGCATTGG - Intergenic
1196903440 X:120409419-120409441 TACAGTGGAGGTACAGGCATTGG + Intergenic
1198426582 X:136527064-136527086 CAAAGTTCAGGTGGAAGGATTGG - Intergenic
1199555673 X:149105893-149105915 CATAGTGTAGGTTAAGGGATAGG - Intergenic
1199826913 X:151509460-151509482 CACTGTGCAGTTGCTGGGGTTGG + Intergenic
1200070792 X:153528068-153528090 CAGAGTGCAGGTGCTGGCTTTGG - Intronic
1201576576 Y:15467642-15467664 GAGAGTGCAGGTGGAAGGATGGG + Intergenic
1202583836 Y:26405296-26405318 GCCAGTGCAGGTTCAGGGAAGGG + Intergenic