ID: 1003306041

View in Genome Browser
Species Human (GRCh38)
Location 6:4930437-4930459
Sequence CCACAGTGCAGGTGCAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 8, 3: 62, 4: 496}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003306041_1003306049 1 Left 1003306041 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 8
3: 62
4: 496
Right 1003306049 6:4930461-4930483 AGCTGCTTTCGGTGGAAAGGCGG No data
1003306041_1003306052 14 Left 1003306041 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 8
3: 62
4: 496
Right 1003306052 6:4930474-4930496 GGAAAGGCGGGTGGACTGTTAGG 0: 1
1: 0
2: 0
3: 14
4: 141
1003306041_1003306051 5 Left 1003306041 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 8
3: 62
4: 496
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306041_1003306048 -2 Left 1003306041 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 8
3: 62
4: 496
Right 1003306048 6:4930458-4930480 GGCAGCTGCTTTCGGTGGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1003306041_1003306046 -10 Left 1003306041 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 8
3: 62
4: 496
Right 1003306046 6:4930450-4930472 TGCACTGTGGCAGCTGCTTTCGG No data
1003306041_1003306047 -7 Left 1003306041 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 8
3: 62
4: 496
Right 1003306047 6:4930453-4930475 ACTGTGGCAGCTGCTTTCGGTGG 0: 1
1: 0
2: 2
3: 11
4: 174
1003306041_1003306050 2 Left 1003306041 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 8
3: 62
4: 496
Right 1003306050 6:4930462-4930484 GCTGCTTTCGGTGGAAAGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003306041 Original CRISPR CCACAGTGCAGGTGCAGGGA TGG (reversed) Intronic
900030184 1:365642-365664 CCACAATCCTGGGGCAGGGAGGG + Intergenic
900075188 1:809377-809399 CCAAAGTGCAAGAGCAGTGATGG + Intergenic
900306981 1:2015265-2015287 CCACAGCGCAGGGGAAGGGACGG - Intergenic
900590210 1:3456098-3456120 CCAGTGTCCAGGTGGAGGGAGGG - Intronic
900700663 1:4046946-4046968 CCCCTGAGTAGGTGCAGGGAGGG - Intergenic
900915153 1:5632375-5632397 CCCCAGTGCTGGCACAGGGAGGG - Intergenic
901122802 1:6908783-6908805 CCACTGAGCAGCTGCAGGGGAGG - Intronic
901322524 1:8348497-8348519 ACTCTGAGCAGGTGCAGGGAGGG - Intergenic
903337422 1:22634474-22634496 CCATGATGCAGGTGAAGGGAAGG - Intergenic
903658086 1:24960988-24961010 CCTCAGGGCTGGTGCATGGATGG - Intronic
903674617 1:25056040-25056062 CCACTGTGCTGGGGAAGGGAGGG + Intergenic
904403885 1:30273939-30273961 CCACATTTCAGGTGAAGAGAGGG - Intergenic
904461539 1:30683663-30683685 CCACAGAGCAGTTCCAGAGAAGG - Intergenic
905316502 1:37084911-37084933 CCACACTGAAAGTGGAGGGATGG + Intergenic
907153033 1:52306599-52306621 CCACATTGCAAGTGAAGAGAAGG + Intronic
907523471 1:55040040-55040062 CCAAGGTGCGGGTGTAGGGATGG + Exonic
908027187 1:59965545-59965567 CCACACAGCAAGTGCAGGAAAGG - Intergenic
908795493 1:67827073-67827095 ACACAATGCAAGTGCAGAGATGG + Intronic
911025116 1:93427567-93427589 CCACATTGCAGGTGAAGAGAAGG + Intergenic
911732773 1:101307644-101307666 TCACTGAGCAGGTGCAGAGAGGG + Intergenic
911802206 1:102156259-102156281 CCATAGTGGAGGTGCTAGGAGGG - Intergenic
912479909 1:109975060-109975082 CCACACTCCAGGTGTAGAGAGGG - Intergenic
912546214 1:110453506-110453528 CCACAGTGCAGAGTCAGGGCTGG + Intronic
912683911 1:111747135-111747157 CCAAAGTGCAGTGGAAGGGAAGG - Intronic
912738724 1:112173978-112174000 CCACCCTGCAGGTCCAGGAAAGG + Intergenic
912943023 1:114061540-114061562 CCACATTGCAGGTAAAGAGAAGG + Intergenic
914248167 1:145901093-145901115 CCACAATGCAAGTCCAGGGCAGG + Intronic
914843935 1:151270136-151270158 CCAGGGTGAAGGTGCAGGGAAGG - Intergenic
914933384 1:151955302-151955324 CCAAAGTGCAGGTACAGGCATGG - Intergenic
915091837 1:153431849-153431871 CCCCAGGGCAGGTGCAGGAGGGG + Intergenic
916442691 1:164843008-164843030 CCACAGTCGAGGTAGAGGGAAGG + Intronic
917539351 1:175898176-175898198 TCACATTGGAGCTGCAGGGAGGG + Intergenic
919860538 1:201736981-201737003 CTACAGTGGAGGTGGAGGGTGGG - Intronic
920684039 1:208095578-208095600 CCACAGAGGAGGAGCAGGGAAGG - Intronic
920913741 1:210241276-210241298 CCACAGTGCAGGCCCCAGGAGGG - Intronic
921218927 1:212959775-212959797 CCGCTGGGGAGGTGCAGGGATGG - Intronic
922095623 1:222440674-222440696 CTAGAGAGCAGGTGTAGGGAAGG - Intergenic
922702100 1:227767223-227767245 CCACTCGGCAGCTGCAGGGAGGG + Intronic
923243929 1:232112585-232112607 CAAAATTGAAGGTGCAGGGATGG + Intergenic
923274622 1:232385527-232385549 CCAAAGGAGAGGTGCAGGGAAGG + Intergenic
924203079 1:241680702-241680724 CCACTGTGAAGGAGCAGAGAAGG - Intronic
924552277 1:245089817-245089839 CCACAGAGAAGGTGAAGGGAGGG + Intronic
1063191391 10:3697925-3697947 GCTCAGTGCAGCTGAAGGGAGGG - Intergenic
1063947468 10:11191812-11191834 CCCCAGTGAAGGAGGAGGGAGGG + Intronic
1064293243 10:14054321-14054343 TCACAGTGCTGGGGCAGGGGAGG - Intronic
1064423688 10:15211905-15211927 CCACAGGGATGGAGCAGGGAAGG + Exonic
1065867200 10:29924575-29924597 CGACAGAGCAGGGGCAGGAAGGG + Intergenic
1067173579 10:43926917-43926939 CCACAGGGCAGGGACAGGGAAGG - Intergenic
1067414438 10:46092713-46092735 CCACAGGGCAGGAGCAGCCAGGG - Intergenic
1067434503 10:46267259-46267281 CCACAGGGCAGGAGCAGCCAGGG - Intergenic
1067439203 10:46299086-46299108 CCACAGGGCAGGAGCAGCCAGGG + Intronic
1067849710 10:49746929-49746951 CCACAGTACAGGTGCCGGCTGGG - Intronic
1069456802 10:68560503-68560525 CCACAGTGGAGAGGCAGGTAGGG - Intergenic
1069823844 10:71243340-71243362 GCACAGTGCTGCTGCAGGGAAGG - Intronic
1069829069 10:71271659-71271681 CCCCAGGGCAGGTGCAGTGCTGG - Intronic
1069892701 10:71661969-71661991 GCACCGTGATGGTGCAGGGATGG - Intronic
1070769059 10:79071638-79071660 CCCCAGTGCAGGGGCCGGGTGGG + Intronic
1070792955 10:79200536-79200558 TGACAGTGCGGGTGCAGGGATGG - Intronic
1073563695 10:104518020-104518042 CCACACTGCAGGAGCAGAGCTGG + Intergenic
1073571237 10:104582743-104582765 CCTCACAGCAGGTGCAGGGGAGG - Intergenic
1074028861 10:109664421-109664443 CCACATTGCAGGTGAAGAGAAGG + Intergenic
1074110270 10:110417776-110417798 CCAGACTCCAGCTGCAGGGATGG + Intergenic
1074991480 10:118712423-118712445 CCACATTGCGGGTGAAGAGAAGG - Intronic
1075743183 10:124708380-124708402 CCAAAGTGCAAAAGCAGGGAAGG + Intronic
1076053615 10:127353644-127353666 CCACAGTGCTGGTGAAGAAAAGG - Intronic
1076078265 10:127554888-127554910 CCACGGTGCTGCTGAAGGGATGG - Intergenic
1076352847 10:129830786-129830808 ACACAGGGCTGATGCAGGGAAGG - Intergenic
1076744325 10:132505107-132505129 CCAGGCTGCTGGTGCAGGGAGGG + Intergenic
1076787964 10:132760452-132760474 CCAAAGTGCAGGGGCACAGATGG - Intronic
1076900596 10:133335741-133335763 CGACAGCGCAGGTGCAGGGAGGG - Intronic
1077021171 11:417737-417759 CAACACCCCAGGTGCAGGGACGG + Intergenic
1077043426 11:534424-534446 CCACAGGGCAGCTGCTGGCAGGG + Intronic
1077094213 11:792523-792545 GCACAGGGCAGGTGGGGGGAGGG - Intronic
1077366825 11:2164627-2164649 GCCCAGTGGAGGTTCAGGGAGGG - Intronic
1079109026 11:17593722-17593744 CCACAGTGCACGTCCAGGCTGGG + Exonic
1079301926 11:19286031-19286053 GCGCAGAGCAGGTACAGGGATGG + Intergenic
1080554797 11:33406398-33406420 CCAGTGTGCATGTGCAGGGGAGG + Intergenic
1080739972 11:35054844-35054866 CCATGGAGCAGGGGCAGGGATGG - Intergenic
1081577497 11:44328335-44328357 CCAGGGTGAAGGGGCAGGGAGGG - Intergenic
1081610499 11:44560003-44560025 AAACAGTGCAGGTTTAGGGAGGG + Intergenic
1081789886 11:45775064-45775086 CCACCCAGCAGGTGCAAGGATGG + Intergenic
1081858124 11:46316679-46316701 CCACAGGCCTTGTGCAGGGAAGG + Intronic
1081911904 11:46705183-46705205 CCACAGTGCGGGCACAGGAAAGG - Exonic
1083260160 11:61518423-61518445 CCACAGTCCAGCTCCGGGGAAGG - Exonic
1083492802 11:63025496-63025518 CAACAGAGCAAGTGCAAGGATGG - Intergenic
1084014704 11:66371635-66371657 CCCCAGCGCAGGTGCAGGTGCGG - Exonic
1084310016 11:68311703-68311725 CCACCTTGCAGGTTCAGAGAGGG - Intergenic
1084427643 11:69094325-69094347 CCCCAGTGCAGGTGGCTGGATGG + Intergenic
1084662495 11:70554327-70554349 CCACAGTGCAGCTTCAGGGAGGG + Intronic
1084936847 11:72591346-72591368 CCACAGTGCACCTGGAGGGATGG + Exonic
1085403863 11:76250221-76250243 CCACATTGCAGGTGATGAGAAGG - Intergenic
1086400817 11:86459857-86459879 GGACAATGCAGGTCCAGGGAAGG + Intronic
1087266841 11:96070361-96070383 CCACATTGCAGGTGAAGAGAAGG + Intronic
1088595799 11:111439341-111439363 AAACAGTGCAGGTGCAGGTCTGG - Intronic
1088796701 11:113271711-113271733 CCCTAGGGCAGCTGCAGGGAGGG - Intronic
1089335027 11:117717257-117717279 GGGCAGTGCAGGTGCAGGGAGGG - Intronic
1089661701 11:119990317-119990339 CCACCCTGCAGCTCCAGGGATGG - Intergenic
1090124820 11:124074965-124074987 CTACATTGCAGGTGAAGAGAAGG - Intergenic
1090575871 11:128102919-128102941 CAGCTGTGCAGGTGCAGAGAAGG + Intergenic
1091582741 12:1798983-1799005 CCACAGTGGAGATGAAGAGATGG + Intronic
1091769269 12:3140750-3140772 CCACAGGGAAGGCTCAGGGAGGG + Intronic
1091819631 12:3466070-3466092 CTCCACAGCAGGTGCAGGGAGGG - Intronic
1092533341 12:9363436-9363458 CTCCACAGCAGGTGCAGGGAGGG + Intergenic
1095890563 12:47231820-47231842 CCAGAGTGCTGGCCCAGGGAAGG + Intronic
1096070432 12:48772408-48772430 CCTTAGTCCAGCTGCAGGGAGGG - Exonic
1096095123 12:48929775-48929797 CCACAGTCCATGAGCAGGAAGGG - Intronic
1096392653 12:51241043-51241065 CCACAGTGCTGGTGGAAGGAGGG + Intronic
1097169848 12:57106473-57106495 TCAAAGTGCAGCTGGAGGGATGG - Intronic
1102045927 12:109830201-109830223 CCACCTTACAGGTGAAGGGATGG + Intronic
1102082143 12:110107087-110107109 CCCCTGTGTAGGTGCAGAGATGG + Intergenic
1104984120 12:132587094-132587116 CGGCAGTGCAGCTGGAGGGAGGG + Intergenic
1104984146 12:132587205-132587227 CGGCAGTGCAGCTGGAGGGAGGG + Intergenic
1104984182 12:132587361-132587383 CGGCAGTGCAGCTGGAGGGAGGG + Intergenic
1105009659 12:132747103-132747125 CCACAGGTCAGGTGGAGGGTGGG + Intronic
1105399013 13:20071561-20071583 CCCCTGTGCAGATGAAGGGATGG + Intronic
1105411409 13:20174590-20174612 CCACCGTGCAGGTGCGAGGGTGG - Intergenic
1106454979 13:29919259-29919281 CCCCAGAGCAGGTTCAGGGCAGG + Intergenic
1106932484 13:34681967-34681989 CCACAGAGCAGGTGCACGGCAGG + Intergenic
1107665154 13:42680858-42680880 CCTCTGAGCAGGTTCAGGGATGG + Intergenic
1107835021 13:44406016-44406038 CCGCTGTCCAGGTGCAGTGAGGG - Intergenic
1109915735 13:68983333-68983355 CCACACTGCAGGTGGCAGGAAGG - Intergenic
1110810736 13:79808409-79808431 CCACATTGCAGGAGAAGAGATGG + Intergenic
1112023158 13:95389698-95389720 GCACAGTGGAGGGGCAGGAATGG + Intergenic
1112077717 13:95931526-95931548 CCACGGTGCCGGGGCAGGGTGGG + Intronic
1112990466 13:105507046-105507068 ACACAGGGCAGGAGGAGGGAAGG + Intergenic
1113107387 13:106786316-106786338 CCCTTGTGCTGGTGCAGGGAAGG + Intergenic
1113316099 13:109181021-109181043 CCACATTGCAGGGGCAGGCCTGG - Intronic
1113710801 13:112463997-112464019 TCCCAGGGCAGGGGCAGGGAAGG + Intergenic
1113783560 13:112989868-112989890 CCACAGATCAGGGGTAGGGATGG + Intronic
1114065321 14:19054765-19054787 GCACAGTGCAAGCGCTGGGATGG + Intergenic
1114096941 14:19345237-19345259 GCACAGTGCAAGCGCTGGGATGG - Intergenic
1116504073 14:45656456-45656478 AGACTGTGCATGTGCAGGGAAGG - Intergenic
1116744945 14:48805800-48805822 CTACAGTACAGGTTTAGGGAGGG + Intergenic
1116840834 14:49819838-49819860 CCTCAGAGCAAGTGAAGGGAGGG - Intronic
1118184543 14:63524797-63524819 CCACAGTGCTGCTGCAGGCCTGG + Intronic
1118795773 14:69142247-69142269 CCAGAGTGCAGGGGCAGTTACGG - Intronic
1119760719 14:77149001-77149023 TCACAGAACAGGTGCAGGAAAGG + Intronic
1120108394 14:80523106-80523128 CCACACTGCTGGTGTAGGGAAGG - Intronic
1120844752 14:89115994-89116016 CCACAGTGATGGTTCAGGGATGG - Intergenic
1120854548 14:89201481-89201503 CCACAGGGCAGGAACAGGAATGG + Intronic
1120893603 14:89510405-89510427 CCTCAGTGCATATGCAGGGCTGG - Intronic
1121176747 14:91896351-91896373 CCAAGGTGCAGGTGAAGGCAGGG - Intronic
1121309300 14:92926576-92926598 ACACAGTGCAGGGGCAGGTTGGG - Intronic
1121317126 14:92968928-92968950 CCACAGAGCACATGCTGGGAAGG + Intronic
1121421779 14:93821072-93821094 CCAAGGTGCAGGGGCGGGGAGGG - Intergenic
1121495095 14:94386616-94386638 CCTGTGTGCAGGTACAGGGAGGG - Intronic
1121537099 14:94698456-94698478 CCACTGTTCAGCTGCAAGGAGGG + Intergenic
1121626138 14:95386698-95386720 CCTAAGAGCAGGCGCAGGGAGGG - Intergenic
1121823783 14:96993606-96993628 CCACTGGGCAGGTTCTGGGAAGG + Intergenic
1122227666 14:100289166-100289188 CCACACTCCAGCTGCAGGCAGGG - Intergenic
1122584251 14:102793700-102793722 CACCAGTGCAGGATCAGGGAAGG + Intronic
1122608220 14:102962433-102962455 GCACAGTGCAGCTGCAGAGGAGG + Intronic
1123491297 15:20784377-20784399 GCACAGTGCAGGCGCTGGGATGG - Intergenic
1123547799 15:21353468-21353490 GCACAGTGCAGGCGCTGGGATGG - Intergenic
1124436371 15:29652499-29652521 CCACATTGCAGGTGAAGAGTGGG + Intergenic
1124709724 15:31997639-31997661 CCCCAGTGCAGACGCAGGGACGG - Intergenic
1124918297 15:33998180-33998202 CTATTGTGCAGGTGGAGGGATGG - Intronic
1126842629 15:52731872-52731894 ACACAGGGCAGCTGCTGGGAAGG - Intergenic
1127215160 15:56816181-56816203 TCACAGGCAAGGTGCAGGGAGGG + Intronic
1127983431 15:64050595-64050617 CCACAGGGATGGGGCAGGGAAGG + Intronic
1128113053 15:65088500-65088522 ACACAGTGAAGGCGGAGGGACGG - Intergenic
1128357149 15:66936187-66936209 CCAGAGTCCAGCTGCAGGGCTGG + Intergenic
1128421020 15:67491727-67491749 CCTCTGGGCATGTGCAGGGAAGG + Intronic
1128660798 15:69499628-69499650 CCAGAGTGCAGGGGCAAGGAAGG - Intergenic
1128716765 15:69914292-69914314 CTGCAGGGCAGGAGCAGGGACGG - Intergenic
1129544581 15:76381769-76381791 CCACAGTGCAGTTGGTGGGGAGG - Intronic
1129679883 15:77652758-77652780 GCACAGTGCGGGAGGAGGGAAGG + Intronic
1129692569 15:77722041-77722063 TCACCCTGCAGGTGCAGAGAGGG - Intronic
1130104743 15:80920952-80920974 CCACATGGCAGGTGCAGGTTGGG - Intronic
1130997742 15:88913156-88913178 CAACAGTGGAGGTGGAGGGCGGG + Intronic
1131027253 15:89154516-89154538 CCACTGAGCAGGGGTAGGGATGG - Intronic
1131390617 15:92044868-92044890 CCACAGAGCAGGTGTTGCGAGGG - Intronic
1131568257 15:93506011-93506033 CCACACTGCAGGTGATGAGAAGG - Intergenic
1131874472 15:96790092-96790114 CCACAGTGAAGGTGTTGGCAGGG + Intergenic
1132336200 15:101050173-101050195 CCCCTGCGCAGGGGCAGGGATGG + Intronic
1132357176 15:101180385-101180407 CCACATGGCAGGTGCACGCATGG + Intronic
1202956129 15_KI270727v1_random:80698-80720 GCACAGTGCAGGCGCTGGGATGG - Intergenic
1132642376 16:983700-983722 GCACAGGGCAGAGGCAGGGATGG - Intronic
1132857521 16:2053436-2053458 CCATCGTGCAGGGGCAGGTAAGG + Exonic
1132959676 16:2614830-2614852 CCTCAGAGCAGGGGCAGGGCTGG - Intergenic
1132972736 16:2696805-2696827 CCTCAGAGCAGGGGCAGGGCTGG - Intronic
1133131407 16:3678262-3678284 CCACATTGCAGGTGCTCGGCAGG - Intronic
1133539214 16:6732419-6732441 CCCCAGTGCAGGTGCAGTGCAGG - Intronic
1135887179 16:26320869-26320891 CCAGAGTCTAGGTGCAGGGTAGG + Intergenic
1136660029 16:31749481-31749503 CTACAGAGCACCTGCAGGGAGGG - Intronic
1136716785 16:32288393-32288415 CAACAGGACAGGTGCAGGGCCGG - Intergenic
1136835161 16:33494638-33494660 CAACAGGACAGGTGCAGGGCCGG - Intergenic
1137351589 16:47718341-47718363 CCATGGTGCAGCTGCATGGAAGG + Intergenic
1138454496 16:57113575-57113597 CCAAAGTGCAGATGCAGAGTGGG + Intronic
1139477013 16:67207817-67207839 CCACGGTGCAGGGGCTGGGCTGG - Intronic
1139586989 16:67910338-67910360 CCACAGAGCAGATGCTGGGAAGG - Intronic
1139673357 16:68506632-68506654 CCGCAGGTCTGGTGCAGGGAGGG + Intergenic
1140521410 16:75585086-75585108 ACAGACTGCAGGAGCAGGGATGG - Intergenic
1140776257 16:78251091-78251113 TCACCCTGCAGGTGCAGAGATGG + Intronic
1141729727 16:85813633-85813655 GCACGGTGCTGTTGCAGGGAAGG - Intergenic
1141759648 16:86019520-86019542 TCAAACTGCAGGTGGAGGGAGGG + Intergenic
1142307679 16:89294718-89294740 TGACAGTGCAGGTACAGGTACGG - Intronic
1142354550 16:89596409-89596431 CCATAATCCAGTTGCAGGGACGG + Intronic
1203009642 16_KI270728v1_random:229394-229416 CAACAGGACAGGTGCAGGGCCGG + Intergenic
1203145334 16_KI270728v1_random:1794959-1794981 CAACAGGACAGGTGCAGGGCCGG - Intergenic
1143907321 17:10219395-10219417 CCACAGTGAATGTGCAAGGGAGG - Intergenic
1143978654 17:10848847-10848869 CCACAGTGCATTGGCAGGGCAGG + Intergenic
1144575262 17:16425853-16425875 CCACAGGGCAGGGGAGGGGAAGG + Intronic
1144601421 17:16617941-16617963 CCGCGGTGCGGGTGCGGGGACGG + Intergenic
1145252810 17:21305625-21305647 CCGAAGTCCAGGTGTAGGGATGG + Intronic
1148228982 17:45919415-45919437 CCACAGAGTAGGGGCAGGTAAGG - Intronic
1148857075 17:50584648-50584670 TCAAAGTGCAGGTGGAGGAACGG + Intronic
1149044742 17:52231569-52231591 CCACAGATCAAATGCAGGGAAGG + Intergenic
1149524625 17:57345204-57345226 CCACAGTGCAGGTGGGAGGGAGG - Intronic
1150344472 17:64393730-64393752 CCATAATGTAGGTGCAAGGAAGG - Intronic
1150809598 17:68346226-68346248 CCATAGAGCAGTTGCAGGGAGGG + Intronic
1151318427 17:73338060-73338082 CCACAGTGATGGTGCATGGAGGG + Exonic
1152231156 17:79114742-79114764 CCCCAGAGCAGGGGCAGGGGAGG + Intronic
1152458377 17:80428768-80428790 AGACAGTGCAGGGCCAGGGAAGG + Intronic
1152573478 17:81130465-81130487 CAGGAGTGCAGGTGCAGGCAGGG - Intronic
1152598610 17:81250325-81250347 CCGCGCTGCAGGTGCAAGGAGGG + Intronic
1152639133 17:81442442-81442464 CCCCCGTGCAGCTGCAGGCAGGG - Exonic
1152785304 17:82244894-82244916 CCACAGTGACGGTGCTGGGCAGG + Intronic
1152884949 17:82844358-82844380 CCACACTGACGATGCAGGGAGGG - Intronic
1152949574 17:83220915-83220937 CCACAATCCTGGGGCAGGGAGGG - Intergenic
1152961080 18:80459-80481 ACAGAGTGCAGGAGGAGGGAAGG + Intergenic
1153625202 18:7016614-7016636 CCACGCTGCAGTTGCAGGGCCGG + Exonic
1153810284 18:8746627-8746649 CCACAGTGCAGCTCGAGAGAAGG - Intronic
1153920350 18:9783373-9783395 CCACAGTGCAGGTAAGGGGGGGG - Intronic
1154162443 18:11990294-11990316 CCACATCCCAGGTGCTGGGATGG - Intronic
1154176265 18:12088486-12088508 GGCCAGTGCAGGTTCAGGGAAGG - Intergenic
1154509255 18:15077877-15077899 CAACAGTGCAGGTGGTGAGAAGG + Intergenic
1155559438 18:27060194-27060216 TCACAGTCAAGGTTCAGGGAGGG + Intronic
1156449643 18:37259643-37259665 CCCCAGAGCAGGGGCAGGGCAGG - Intronic
1156610522 18:38718723-38718745 CCACAGCGCATGTGCAGCGCCGG + Intergenic
1157209823 18:45732629-45732651 CCACACTGCAGGGGCTGGTAAGG - Intronic
1157439633 18:47700706-47700728 CCACAGTGGTTGTCCAGGGATGG - Intergenic
1158215496 18:55096748-55096770 CGACAGTGCAGTGGAAGGGATGG - Intergenic
1160352617 18:78196997-78197019 CCACAGTGCAGGTGGGAAGAAGG - Intergenic
1160397687 18:78584125-78584147 CCACAGTGCAGAGGCAGAGGGGG - Intergenic
1160535366 18:79588768-79588790 CCTCCGTGCAGGGGCTGGGAGGG - Intergenic
1161129450 19:2579445-2579467 CAACAGGGCGGGTGCAGGAAAGG + Intronic
1161206731 19:3045334-3045356 CCACAGGGAAGGTGCCAGGAAGG + Intronic
1161868292 19:6850806-6850828 CCAAGGCGGAGGTGCAGGGAGGG - Intronic
1161869032 19:6856327-6856349 TCACATTGCAGTTGCAGGGAGGG + Intronic
1162128749 19:8512847-8512869 CCACAGTGCAGGGGCTGGACTGG + Intronic
1162562485 19:11425765-11425787 CCTCAGGGCAGGTGCAGGGGCGG + Intronic
1162612344 19:11766660-11766682 CCACACTGCAGCAGAAGGGAGGG - Intergenic
1162849160 19:13417315-13417337 CCACTGGGCAGGAACAGGGAGGG + Intronic
1163012330 19:14433689-14433711 CCACAGTCCCGGCCCAGGGAGGG - Intronic
1163267179 19:16228300-16228322 CCACAGTGAGGGTGCACGGATGG - Intronic
1163695774 19:18762579-18762601 CCAGAGTGCAGGAGGAGGGCAGG + Intronic
1164427768 19:28157679-28157701 TCTCAGTGCAGGTGCATGGTGGG - Intergenic
1164547570 19:29181751-29181773 CGACAGTGCAGGAGCAGGTAGGG + Intergenic
1164640544 19:29822161-29822183 CCTCACTCCAGCTGCAGGGAAGG - Intronic
1166254411 19:41592205-41592227 CCACCCTGTAGGTCCAGGGATGG + Intronic
1166258108 19:41620148-41620170 CAACAGTGCAGGCTCAGGGCAGG - Intronic
1166702932 19:44892509-44892531 CGAGTGTGCAGATGCAGGGAGGG - Intronic
1166774291 19:45302988-45303010 GGACAGGGCAGGGGCAGGGAGGG + Exonic
1166819496 19:45568775-45568797 CCACAGAGACGGTGCTGGGATGG + Intronic
1166921336 19:46230988-46231010 CCTCAGGGCAGCTGCAGGGTGGG - Exonic
1167094348 19:47366230-47366252 CCACTGTGCAGAGGCAGGCAAGG - Intronic
1167291132 19:48625830-48625852 CCCCATGGCAGGGGCAGGGAGGG - Intronic
1167293173 19:48635568-48635590 CCACCGCGCAGGTGCGGCGAAGG - Exonic
1167721424 19:51182760-51182782 CCAGGGTGCAGGGGCAGCGAGGG + Intergenic
1167729238 19:51241136-51241158 CCAGGGTGCAGGGGCAGTGAGGG + Intronic
1167763552 19:51464010-51464032 CCAGGGTGCAGGGGCAGCGAGGG - Intergenic
1168235878 19:55062905-55062927 CCCCAGCGCAGGGGCCGGGAAGG - Intronic
925064791 2:921594-921616 CCACAGCAGAGGGGCAGGGATGG - Intergenic
925082747 2:1082647-1082669 CCGGAGTGCAGGAGCAGGGGTGG - Intronic
925154861 2:1640994-1641016 GCACAGAGCAGGTGCAGGCCAGG - Intronic
925370691 2:3343164-3343186 CCACAGGGCAGGTGGCGGGGCGG - Intronic
925379701 2:3416630-3416652 GCACAGTGAAGGGGCAGGGGAGG - Intronic
927146990 2:20172616-20172638 TCACAGTGATGGTGCAGGCAGGG + Intergenic
928393582 2:30927547-30927569 CCAGAGTACAGGTGGAGGGATGG + Intronic
929246281 2:39707095-39707117 CCACAATGCAGCCGCAGAGAAGG - Exonic
930091636 2:47535281-47535303 CCATAGGGCAGGTGCAGGTCGGG - Intronic
930752995 2:54949993-54950015 TCACTGTGCAGGTGGAAGGATGG - Intronic
932026626 2:68140259-68140281 CCACAGTGGAAATGCAGGGCTGG - Intronic
933639261 2:84741684-84741706 CCACTGTGCTGCTCCAGGGAGGG - Intronic
933834392 2:86233601-86233623 TCACAGTGAAGGCTCAGGGATGG + Intronic
933866474 2:86522761-86522783 ACAGAGCACAGGTGCAGGGAGGG - Intronic
933974621 2:87498354-87498376 CCACAGTGCAGGAGCGAGGACGG - Intergenic
934652980 2:96103075-96103097 CCTCAGTGCAGGGCCACGGAGGG - Intergenic
934773021 2:96919995-96920017 GAACAGTGCAGGGGAAGGGAAGG + Intronic
935178348 2:100668940-100668962 CCACAGAGCATGGGCAGAGAGGG - Intergenic
935794065 2:106623806-106623828 TGCCAATGCAGGTGCAGGGAAGG - Intergenic
936319203 2:111452460-111452482 CCACAGTGCAGGAGCGAGGACGG + Intergenic
937214561 2:120303384-120303406 CAAGGGTGCAGGTGGAGGGATGG - Intergenic
937357718 2:121208834-121208856 CCACAATAGAGGGGCAGGGACGG + Intergenic
937927379 2:127177480-127177502 CCACAGTGCAGATGCTGGGATGG + Intergenic
937970442 2:127545306-127545328 CCACAGTGCATGGGCAGGCAGGG + Intronic
938482579 2:131673767-131673789 GCACAGTGCAGGCGCTGGGATGG + Intergenic
940612139 2:156005991-156006013 CCACATTGTGGGTGAAGGGAAGG - Intergenic
940886865 2:158997847-158997869 CCACACTCAAGGTGTAGGGAGGG - Intronic
941408442 2:165121744-165121766 CCAGAGTGCGGGTTCTGGGAGGG - Intronic
944141298 2:196459769-196459791 CCACGGAGGATGTGCAGGGAGGG + Intronic
944473693 2:200082840-200082862 CCTCACTGCAAATGCAGGGATGG - Intergenic
944696073 2:202201560-202201582 CCACAGTGCTGGTGGAAGGCGGG - Intergenic
946816566 2:223584314-223584336 CCACAGGGAAGGTTCAAGGATGG - Intergenic
947327184 2:228991901-228991923 CCACATTGCAGGTGAAGAGAAGG - Intronic
948363100 2:237436552-237436574 GCACAGAGCAGGTGCAGTGGTGG - Intergenic
948459766 2:238123533-238123555 CCACAGAGCAGGGGCCGGGGAGG - Intronic
948584560 2:239011392-239011414 TCACAGGGCAGGTCCAAGGAGGG - Intergenic
948672286 2:239576207-239576229 CCCCAGTGAAGCTCCAGGGAAGG - Intergenic
948723465 2:239918125-239918147 CCCCAGAGCAGGTCCAAGGAGGG - Intronic
948797282 2:240411555-240411577 CCACAGTGCAGGCCCAGGATAGG - Intergenic
948846072 2:240683365-240683387 ACACAGTGCAGGTTCAGTGGGGG - Intergenic
948847784 2:240691364-240691386 ACACAGTGCAGGTTCAGTGGGGG + Intergenic
948869716 2:240791918-240791940 CCCCAGTGCAGGGCCTGGGATGG - Intronic
948945024 2:241215075-241215097 CCACAGGGCAGCTGCAGGGCGGG - Intronic
949030721 2:241795940-241795962 GTAGAGTGCAGGTGAAGGGAGGG + Intronic
949082533 2:242115407-242115429 CCAAAGTGCAAGAGCAGTGATGG - Intergenic
1169609051 20:7358839-7358861 GCAGACTGCAGGTGCAGGAAGGG - Intergenic
1169713734 20:8592853-8592875 TCACAGTGATGCTGCAGGGAAGG + Intronic
1170004025 20:11646568-11646590 CCACTGTGATGGCGCAGGGAAGG + Intergenic
1170580623 20:17697062-17697084 CCACAGTGCAGGTGTGAGGCTGG + Intronic
1171189535 20:23149438-23149460 TCACGGTGTAGGTGCAGGGAAGG - Intergenic
1171208132 20:23296885-23296907 CCACTGAGCCAGTGCAGGGATGG - Intergenic
1172250805 20:33477784-33477806 CCAGAGTGCAGGGGGAGGAAAGG + Intergenic
1172624066 20:36337374-36337396 CCGCTGGGTAGGTGCAGGGAAGG + Intronic
1172789599 20:37493705-37493727 CAACAGTGCAGATGGAGAGAAGG - Intronic
1173392224 20:42645470-42645492 ACACAGTGAAGGCTCAGGGAAGG - Intronic
1173488329 20:43457952-43457974 CCGCGGTGCGGGTGCGGGGACGG - Exonic
1173854519 20:46241454-46241476 GCAGAGTCCAGGGGCAGGGAGGG - Intronic
1174339290 20:49886086-49886108 GGACGGGGCAGGTGCAGGGAGGG - Intronic
1174361502 20:50031642-50031664 ACATAATGCAGGTGCATGGATGG - Intergenic
1174499818 20:50976242-50976264 CCCCAGTCCAGATCCAGGGATGG - Intergenic
1175372215 20:58499665-58499687 CCACAGAGCAGGAGCAGGTAGGG - Intronic
1175431864 20:58910724-58910746 CCACAGCGCAGGTGAAATGAGGG - Exonic
1175445826 20:59018817-59018839 CGACAGAGCAGGGGCTGGGAAGG + Intergenic
1175912746 20:62412592-62412614 GCATGGGGCAGGTGCAGGGAAGG - Intronic
1176130331 20:63494118-63494140 CCACAGTGAGGGTGCAGGTGTGG - Intronic
1176206410 20:63891016-63891038 CCACAGGTCAGGTGGAGGGTGGG + Exonic
1176408492 21:6434840-6434862 CCACATTACAGGTGAAGTGAAGG + Intergenic
1176447325 21:6831438-6831460 GCACAGTGCAGGTGCTGGGATGG + Intergenic
1176788814 21:13293931-13293953 CAACAGTGCAGGTGGTGAGAAGG - Intergenic
1176825493 21:13696464-13696486 GCACAGTGCAGGTGCTGGGATGG + Intergenic
1176868645 21:14070711-14070733 CCACAGTGCTGGGGCGTGGAGGG + Intergenic
1177011997 21:15742029-15742051 ACATAGTGCAGTTGCAGGGGTGG + Intronic
1177987977 21:28002072-28002094 CAACAGTGCAGGTGGTGAGAAGG - Intergenic
1178202492 21:30423306-30423328 CCAAATTGCAGATGCAGGAATGG - Intronic
1178467018 21:32858304-32858326 CCACATTACAGGTGAAGAGATGG - Intergenic
1178590327 21:33904277-33904299 ACACAGAGCAGAGGCAGGGAGGG - Intronic
1178782984 21:35623862-35623884 CCACAGTGGAGGGGGAAGGAGGG - Intronic
1179242533 21:39604842-39604864 CCACAATGGAGATGCAGGAAAGG - Intronic
1179539854 21:42077128-42077150 CCACAGTGGGGGTGCAAGGCAGG - Intronic
1179683985 21:43043166-43043188 CCACATTACAGGTGAAGTGAAGG + Intergenic
1179839031 21:44058380-44058402 CCAGAGGGCTGGTGCTGGGAAGG + Intronic
1179912728 21:44459013-44459035 CCACAGTGCAGACGCGGGGTGGG + Exonic
1180199794 21:46217479-46217501 CCACAGTCAGGGAGCAGGGAAGG - Intronic
1180483812 22:15777385-15777407 GCACAGTGCAAGCGCTGGGATGG + Intergenic
1180898867 22:19356803-19356825 CCTCACTGCAGGGGCAGGGAAGG - Intronic
1181033894 22:20160873-20160895 ACCCAGTGCAGGGCCAGGGAAGG + Intergenic
1181115719 22:20631635-20631657 CATCAATGCAGGTGCAGAGAGGG + Intergenic
1181590629 22:23882886-23882908 CCACAGGGCTGGTGGAGGAAGGG - Intronic
1181811557 22:25406270-25406292 CCACCTTGCAGGTTCAGAGAGGG + Intergenic
1182511964 22:30826318-30826340 CCACTCTGCAGGTGCAGGGAAGG - Intronic
1182658351 22:31907187-31907209 CCACTGGGCAGGAGCAAGGATGG + Intergenic
1182680295 22:32074204-32074226 CCTCAGAGCTGGTGCAGGGGTGG + Intronic
1183118758 22:35713389-35713411 CCAGAGAGAGGGTGCAGGGAGGG - Intergenic
1183362308 22:37389117-37389139 GCACAGTGCAGGTGCTGCCAAGG + Intronic
1184296330 22:43527665-43527687 ACCCTGTGCAGGGGCAGGGAAGG + Intergenic
1184491191 22:44810087-44810109 GCACAGTGAGGCTGCAGGGAAGG - Intronic
1184643053 22:45882391-45882413 CCACAGTCCAGGTCCTGGGAGGG + Intergenic
1184671385 22:46013800-46013822 TCACCGTCCAGGTGCAGGGTGGG + Intergenic
1184869362 22:47225487-47225509 CCACATTGCAGGTGAAGAGAAGG - Intergenic
1185172022 22:49299706-49299728 CCACAGCTCATGTGCTGGGAAGG - Intergenic
1185221223 22:49630109-49630131 CCACAGGGCAGGTGCTGGCCAGG + Intronic
950098468 3:10343561-10343583 CCACTGTCCAGGTTCTGGGAGGG + Intronic
950525519 3:13520681-13520703 CCACACAGCATGTGCAGGGCAGG - Intergenic
950685542 3:14616106-14616128 CCAGAGGGCAGGGGCAGGAAGGG + Intergenic
950840018 3:15959166-15959188 CCACACTGCAGCTGAAGGCAGGG - Intergenic
951054814 3:18135502-18135524 CCACAGACCTGGTGCAGGGCAGG - Intronic
951502985 3:23411203-23411225 CAACAGTTCAGGAGCAGAGAGGG - Intronic
953264057 3:41369232-41369254 CCAAAGTGCTGGTACAGGCAGGG - Intronic
953916216 3:46922669-46922691 CCACAGTGGAGGGGCTGGGCCGG - Intronic
953969256 3:47334325-47334347 CCACGGTGCAGTCGTAGGGATGG + Intronic
954156127 3:48685814-48685836 GGGCAGGGCAGGTGCAGGGAAGG + Exonic
955757323 3:62238640-62238662 TAACAGAGCAGGTGCAGGGTGGG - Intronic
956400419 3:68873618-68873640 CCACAGGACACTTGCAGGGAGGG + Intronic
956771065 3:72526310-72526332 CCAGACTTCAGGTGCAGGAAGGG + Intergenic
957670758 3:83299440-83299462 CCACATGGCAGGTTGAGGGAAGG + Intergenic
958960827 3:100508089-100508111 CCTCAGTGCAGGAAAAGGGAAGG + Intronic
959513653 3:107241445-107241467 CAGAGGTGCAGGTGCAGGGAGGG - Intergenic
961377705 3:126477262-126477284 AGACAGTGAAGGAGCAGGGAAGG - Intergenic
961500169 3:127326743-127326765 ACACACTGCAGATCCAGGGAGGG + Intergenic
962311711 3:134331524-134331546 CCACATTCCAGGATCAGGGATGG - Intergenic
963393016 3:144693236-144693258 CCACAGTGAAGCTGCTGTGAAGG - Intergenic
964317179 3:155457137-155457159 CCACAGTGTAGAAGCATGGAGGG - Intronic
965309826 3:167115105-167115127 TCACATTGCAGGTGAAGAGAAGG - Intergenic
966409181 3:179631106-179631128 CCTGAGTGCATGTGCAGGGAAGG + Intergenic
967171967 3:186828750-186828772 CCACAGAGCAGGGGCGGGGGTGG + Intergenic
967557370 3:190875727-190875749 CCACTGTGCAGAGGCAGGCAAGG - Intronic
967856664 3:194123007-194123029 CCACAGAACTGGAGCAGGGAGGG + Intergenic
968126522 3:196164176-196164198 CCACAGAGCAGGTGCAGGGCTGG - Intergenic
968701037 4:2058613-2058635 CCTCGGTGCAGGTGCAGCGGGGG - Intergenic
968745544 4:2357961-2357983 CCACAACGCAGGTGCATGAAAGG + Intronic
968800932 4:2742906-2742928 CCACAGAGGAGGTGCAGAGTAGG - Intronic
968961757 4:3749100-3749122 CCAGAGTGCAGCTGCAGAAAGGG + Intergenic
968975280 4:3819052-3819074 CCACGATCCAGGTGCAGGCATGG + Intergenic
969138808 4:5051703-5051725 GCACCGTGCAGGGGCGGGGACGG - Exonic
969214460 4:5711132-5711154 GCTCAGTGCAGGGGCAGGGCTGG + Intergenic
969305754 4:6325460-6325482 CCACTGTGCTGGCGCGGGGAGGG - Intronic
969441975 4:7222658-7222680 GCAGAGGGCTGGTGCAGGGAGGG + Intronic
969464034 4:7344203-7344225 CCCCAGTGCAGGGCCTGGGATGG + Intronic
970317789 4:14845888-14845910 CCCCAATGCAGGTGGAGGAAGGG - Intergenic
970552553 4:17197232-17197254 CCACACTGAAGGTGCTGGGCAGG + Intergenic
972182760 4:36489134-36489156 CTCCAGTGCAGGTCCAGGGAAGG - Intergenic
974619979 4:64341641-64341663 CCACGTTGCAGGTGAAGAGAAGG + Intronic
976701341 4:87971982-87972004 CCACATTGGAGTTGAAGGGATGG - Intergenic
977292970 4:95182998-95183020 CCAGAGTGAAGGTGCAGTGCAGG + Exonic
977305352 4:95317587-95317609 TCACAGTGCAGGGGCTGGCAAGG + Intronic
977558858 4:98512353-98512375 CCACAGAGCAAGCTCAGGGACGG + Intronic
979707403 4:123736693-123736715 CCACAGTGTTTGTGTAGGGAGGG + Intergenic
979830641 4:125296909-125296931 CCAGAGGGCAGGGGCAGGCAAGG - Intergenic
979897960 4:126184684-126184706 CCACAGTTCAGTTGAAGGGAAGG + Intergenic
980225932 4:129985680-129985702 CCACAGGGCAGCTGGAAGGATGG + Intergenic
982240893 4:153298354-153298376 CCAAAATCCAGGTGCTGGGAGGG + Intronic
982532177 4:156558689-156558711 CCACAGTGTAGCTCCAGGTAGGG + Intergenic
982873187 4:160609957-160609979 CCTAAGTTCAGGTGCAGTGAGGG - Intergenic
984763116 4:183379090-183379112 CCACAGTGCAGAAGCAGGGCAGG - Intergenic
984812849 4:183810190-183810212 CCACCTTGCAGTTGCAGGGAGGG + Intergenic
985761672 5:1752156-1752178 GCACAGAGCAGGGGCAGGGAGGG - Intergenic
985808477 5:2065935-2065957 ACACAGTACAGGAGCAGAGACGG - Intergenic
986733841 5:10653865-10653887 CCACATGGCAGATCCAGGGAGGG - Intergenic
986736781 5:10674014-10674036 GCACATTGCAGGCACAGGGAGGG + Intergenic
986785106 5:11106909-11106931 CCACAGTTCAGGAGCAGAAATGG - Intronic
987579273 5:19767984-19768006 CTGCAGTGGAGGTGGAGGGAGGG - Intronic
987875477 5:23675321-23675343 CCACATTGCAGGCGATGGGAAGG + Intergenic
988458196 5:31406899-31406921 CCACAGTGTAGGTTCGGGCATGG + Exonic
988684548 5:33514431-33514453 CCACAGTGCATGGACAGGGAAGG + Intergenic
990173804 5:53084684-53084706 CCACACTGCAGCAGCTGGGAAGG - Intronic
990449972 5:55924850-55924872 CTACAGTCCAGGTGCTGGCAGGG + Intergenic
992479695 5:77138274-77138296 CCAGAGGGAAGGTGTAGGGAAGG - Intergenic
996595409 5:125196462-125196484 CCGCACTGCAGGTGCAGAGTGGG + Intergenic
997382589 5:133448397-133448419 CCAGAGTGCAGGTGTGTGGACGG + Intronic
997592791 5:135086100-135086122 CCACGGGGCTGGTGCAGGAAAGG - Intronic
999823825 5:155255112-155255134 TCACAGTGGAGGAGCAGAGAGGG + Intergenic
999888458 5:155950459-155950481 CCATAGTGAAAGTTCAGGGACGG - Intronic
1000334882 5:160234821-160234843 CCACTGTGCAGATGGAGGGCGGG + Exonic
1000608515 5:163350153-163350175 CCACAGGGTAGGGGCAGGGAAGG - Intergenic
1001059063 5:168472793-168472815 GCAAAGTGCTGGTGGAGGGAAGG - Intergenic
1002197439 5:177509088-177509110 GGACAGTGCCGCTGCAGGGAGGG + Intronic
1002321324 5:178377735-178377757 CGAGAGAGCAGGTGCAGGGCAGG + Intronic
1002743805 5:181454730-181454752 CCACAATCCTGGGGCAGGGAGGG - Intergenic
1003030826 6:2599095-2599117 ACACAGGGCAGGAGCAGTGAGGG - Intergenic
1003040454 6:2682965-2682987 CCACTGTGCAAGAGCTGGGAAGG + Intronic
1003115265 6:3279671-3279693 CCACATTTCAGGGGCAGGAAAGG - Intronic
1003306041 6:4930437-4930459 CCACAGTGCAGGTGCAGGGATGG - Intronic
1003328344 6:5109607-5109629 CCGCAGTGCAGTTGCCGGAAGGG - Intronic
1003869923 6:10393550-10393572 CTACATTACAGGTGCAGAGATGG - Intronic
1007081081 6:39104770-39104792 CCTAAGTGCAGGTGTGGGGAGGG - Exonic
1007712476 6:43833574-43833596 CCCCAGTGAGGCTGCAGGGACGG + Intergenic
1007789666 6:44301779-44301801 CCACAGTGGAGGTGCAATCAGGG + Intronic
1010295839 6:74194764-74194786 CCACAGGGCAGCTGCAGTGAAGG + Intergenic
1013466109 6:110418424-110418446 ACATACTGCAGGTGCTGGGAAGG + Intergenic
1016479509 6:144467107-144467129 TCACAGTGGAGATGCAGGGAGGG - Intronic
1016648344 6:146435259-146435281 AGACAGAGCAGGTGCGGGGAAGG + Exonic
1017940495 6:159048573-159048595 CCACTATGCAGGGCCAGGGAAGG - Intergenic
1018867829 6:167759386-167759408 CCAAAGTTCAGGAGAAGGGACGG + Intergenic
1019054684 6:169214432-169214454 CCACAGGGCAGGTGCTCGCACGG + Intergenic
1019135796 6:169906884-169906906 CCGCAGAGGATGTGCAGGGAAGG + Intergenic
1019248664 6:170727959-170727981 CCACAATCCTGGGGCAGGGAGGG - Intergenic
1019304639 7:327465-327487 CGACAGTGCAGGTGCCTGGCGGG - Intergenic
1019664559 7:2245055-2245077 CAACAGTGAGGGTGCTGGGAGGG - Intronic
1019684658 7:2374464-2374486 CCACAGTGCCGGGGCAGCCAAGG - Intronic
1019769301 7:2873496-2873518 CCAAACTCGAGGTGCAGGGAAGG - Intergenic
1019943391 7:4308509-4308531 CCCCTCTGAAGGTGCAGGGAAGG + Intergenic
1021447108 7:20745683-20745705 CCACAGTGTAGATGGATGGAAGG - Intronic
1021622675 7:22563843-22563865 CCACAGTCCACGTCCCGGGAAGG - Intronic
1022478097 7:30725039-30725061 CCACTGTGAGGCTGCAGGGAAGG - Intronic
1022795841 7:33730867-33730889 GCACAGGGCACATGCAGGGAGGG - Intergenic
1023284349 7:38603748-38603770 CCAGACTGCATGAGCAGGGAGGG - Intronic
1023633591 7:42186591-42186613 CCATAGTGCAGTTGCACTGATGG - Intronic
1023937733 7:44751202-44751224 GCACAGGGCAGGTACAAGGAGGG - Intronic
1024063370 7:45714820-45714842 ACACAGTGCCGGTGCAGGATGGG - Exonic
1024185725 7:46946101-46946123 TCACAGGGAAGGGGCAGGGAGGG + Intergenic
1024614554 7:51100024-51100046 CCACAGTGGAGGTGGTGGCAAGG - Intronic
1024629510 7:51235680-51235702 CCACAGGGCAGGTGCTGGTTTGG + Intronic
1025195179 7:56927010-56927032 TCCCAGTGCAGGTACAAGGAGGG + Intergenic
1025676773 7:63649933-63649955 TCCCAGTGCAGGTACAAGGAGGG - Intergenic
1026027831 7:66761527-66761549 ACACAGTGCAGGTTCCTGGAGGG - Intronic
1026108364 7:67438705-67438727 CCACAGGGCAGGTGCATGAAAGG - Intergenic
1026586723 7:71661612-71661634 CCACAGTGCATGCCCAGTGATGG + Intronic
1026929460 7:74215810-74215832 GCCCAGTGCAGGAGCGGGGAGGG + Intronic
1029092012 7:98055928-98055950 CCACAGTTCAGGTGTTGGCAGGG + Intergenic
1029257073 7:99276681-99276703 ACACAGTGCAGGAGGAGGGCAGG + Intergenic
1029646415 7:101859222-101859244 CCCCAGCTCAGGTGCAGGGAGGG - Intronic
1031640148 7:124153092-124153114 CCAGAGTGTAGGAGCAGGCAGGG + Intergenic
1031901391 7:127415213-127415235 CCCGGGTGCAGGTGCAAGGAGGG - Intronic
1033494513 7:141880788-141880810 CCACAGGGCAGGTCCAGAAAGGG - Intergenic
1034243419 7:149626330-149626352 GCACAGAGCTGGTGCAGGAAAGG + Intergenic
1034834115 7:154336317-154336339 ACACAGTGGTGGTGCCGGGATGG + Intronic
1035257265 7:157638770-157638792 CGACAAGGCAGCTGCAGGGAGGG - Intronic
1035340325 7:158156733-158156755 GCACAGGGCAGGTGTAGGGAAGG - Intronic
1035350777 7:158245074-158245096 CCACGCTGCAGATGCAGGGCTGG - Intronic
1035540455 8:432110-432132 CCAAAGTGCAAGAGCAGTGATGG - Intronic
1035666030 8:1380010-1380032 CCAGGGTGCAGATGCTGGGATGG - Intergenic
1036715909 8:11123856-11123878 GCACAGTGCAGGTGCCAGGTGGG - Intronic
1037137502 8:15480677-15480699 CAAGGATGCAGGTGCAGGGAGGG - Intronic
1037316962 8:17608311-17608333 CAACAGTGCTGTTACAGGGAAGG - Intronic
1037728174 8:21501275-21501297 ACACAGTGCTGGAGCAGGGAGGG + Intergenic
1037837373 8:22222041-22222063 CCAGAATGCAAGAGCAGGGAGGG + Intronic
1038653697 8:29429135-29429157 CCACAGTGAAGGTGTGGGGGAGG - Intergenic
1039102739 8:33958130-33958152 CCACAGGGCAGCTGCACTGAAGG + Intergenic
1040457152 8:47610225-47610247 CCAGATTGCAGCTGCAGGAATGG - Intronic
1040869811 8:52089087-52089109 CACCAGCGCTGGTGCAGGGAAGG + Intergenic
1041734485 8:61095351-61095373 CCCCAGAGCAGGGGCAGGGCTGG + Intronic
1041784474 8:61616275-61616297 CGACAGTGCAGGGGAAGGTACGG + Intronic
1042143862 8:65707070-65707092 CCCCAGTGCAGGGGGAGGCAGGG - Exonic
1043437818 8:80251729-80251751 CCAATGAGGAGGTGCAGGGAAGG + Intergenic
1043737632 8:83768089-83768111 CCACATTGCAGGTGATGGGAAGG - Intergenic
1044802878 8:95975172-95975194 CTACAGTGAAGATGCAGGCAGGG - Intergenic
1045240533 8:100396727-100396749 TCTCAGTGCATCTGCAGGGAGGG - Intronic
1045393317 8:101736382-101736404 CCACACTGCAGGGACAGGAAAGG + Intronic
1045664394 8:104469380-104469402 CCACAGTGATGATACAGGGATGG + Intergenic
1046664583 8:116986698-116986720 CCACAGTGCAGGATTGGGGAAGG + Intronic
1046958909 8:120089158-120089180 CCACAGTGCAGGTGTCAGGAGGG + Intronic
1047388014 8:124427362-124427384 CCAAAGTGAAGGTGCTGGCAGGG + Intergenic
1047555307 8:125923049-125923071 CCATAGTGCAGGTGTAGAAAGGG + Intergenic
1047623789 8:126635119-126635141 CCACAGTGCAGCTGCGCGGCAGG - Intergenic
1047875114 8:129127851-129127873 CCACAGTTCAGGTTCTGGAATGG + Intergenic
1048751525 8:137682075-137682097 ACTAAGTGCAGGTGCAGTGATGG - Intergenic
1048832828 8:138493032-138493054 CCACACCGGAGGTGGAGGGAGGG + Intronic
1048853504 8:138666605-138666627 ACACAGTTCAGATGCAGGTATGG - Intronic
1048983969 8:139720662-139720684 CCACTGTGCAGGTGAAGAAATGG + Intergenic
1049350530 8:142162072-142162094 CCCAAGTGCAAGTACAGGGAAGG + Intergenic
1049708606 8:144053859-144053881 GCACTGAGCAGCTGCAGGGAAGG - Intronic
1049770425 8:144377964-144377986 AGAGAGTGCAGGGGCAGGGATGG + Intronic
1049805749 8:144538042-144538064 CGTGAGTGGAGGTGCAGGGAAGG + Intronic
1049944211 9:579114-579136 GCACACTGAAGCTGCAGGGATGG + Intronic
1051779878 9:20678689-20678711 CCACAGTGATGCTACAGGGAGGG - Intronic
1052352013 9:27467640-27467662 CCCCAGGGCAAGTGGAGGGATGG + Intronic
1056468015 9:86877945-86877967 CGACAATGCAGGTGCAGCCAAGG - Intergenic
1056559642 9:87718969-87718991 TCACAGAGCAGGTGGAGGGTGGG - Intergenic
1057145691 9:92757811-92757833 GCAAACTGCAGGTGCAGGGCAGG + Intronic
1057568242 9:96183898-96183920 CTACAGGGCAGGTGCAGGTGAGG + Intergenic
1057704234 9:97386370-97386392 CCAGACTGCAGGTGCTGGGCAGG - Intergenic
1058764791 9:108171442-108171464 CCACAGTGAAGGGGAAGGAAGGG + Intergenic
1059401301 9:114072116-114072138 CCACATTGCAGGTGAAGAGAAGG + Intronic
1060870086 9:127033037-127033059 CCACAGAGCAGGTGCTGGACAGG - Intronic
1061594875 9:131622256-131622278 GCACATGGCGGGTGCAGGGATGG + Intronic
1061728341 9:132594004-132594026 ACACAATGCAGGGGCAGGGCGGG + Exonic
1061904335 9:133688945-133688967 CCACAGTGCATATGCTTGGACGG + Intronic
1061980310 9:134099247-134099269 TCACAGTGCAGGTGCCTGGTGGG - Intergenic
1062306212 9:135908134-135908156 CCCCCGTCCCGGTGCAGGGAAGG + Intergenic
1062352936 9:136148041-136148063 CCACACAGCAGGTGGAGGGATGG + Intergenic
1062527409 9:136983546-136983568 CTGCAGGGCAAGTGCAGGGAAGG - Exonic
1062562481 9:137147818-137147840 CCACACAGCAGGTGCACGGCAGG + Intronic
1062672938 9:137722600-137722622 GCACACCGCAGGTGCAGGGCAGG - Intronic
1062730105 9:138103924-138103946 GCACAATGCAGGGGCAGGGCAGG - Intronic
1062737080 9:138143527-138143549 ACAGAGTGCAGGAGGAGGGAAGG - Intergenic
1203521865 Un_GL000213v1:53093-53115 GCACAGTGCAGGTGCTGGGATGG - Intergenic
1203609623 Un_KI270748v1:85223-85245 CCACAATCCTGGGGCAGGGAGGG - Intergenic
1185461114 X:333170-333192 CAACAGGACAGGTGCAGGGCAGG - Intergenic
1186602751 X:11056025-11056047 CCAAAGTGCAGGTGCAGGACCGG - Intergenic
1190180026 X:48184349-48184371 CCACAAGACAGGTGCAAGGAAGG - Intergenic
1190204952 X:48395111-48395133 CCACAAGACAGGTGCAAGGAAGG + Intergenic
1190205584 X:48400292-48400314 CCACAAGACAGGTGCAAGGAAGG - Intergenic
1190569607 X:51768211-51768233 CCTGAGTGTGGGTGCAGGGAGGG - Intergenic
1190658773 X:52635678-52635700 CCACAAGACAGGTGCAAGGAAGG + Intergenic
1191743071 X:64456223-64456245 TCACAGTGAATGTTCAGGGATGG + Intergenic
1193467535 X:81867272-81867294 CCACATTGCAGGTGAAGAGAAGG - Intergenic
1193468668 X:81874835-81874857 CCACATTGCAGGTGAAGACAAGG - Intergenic
1195136071 X:101908551-101908573 CCAGGCTGCAGCTGCAGGGATGG - Intronic
1197967175 X:132077638-132077660 CCACAGTGCTGGTGAGGAGAGGG + Exonic
1198189549 X:134288512-134288534 CCACATTGCAGGTGATGAGAAGG + Intergenic
1198896463 X:141461061-141461083 CCAAAGTGTAGTTGCAGGGGAGG - Intergenic
1200397437 X:155999429-155999451 TCATAGAGAAGGTGCAGGGAAGG - Intronic
1201651101 Y:16288051-16288073 GAACAGTGCAGGTACAGAGAAGG - Intergenic
1202583835 Y:26405295-26405317 GGCCAGTGCAGGTTCAGGGAAGG + Intergenic