ID: 1003306043

View in Genome Browser
Species Human (GRCh38)
Location 6:4930441-4930463
Sequence GCTGCCACAGTGCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003306043_1003306051 1 Left 1003306043 6:4930441-4930463 CCCTGCACCTGCACTGTGGCAGC 0: 1
1: 0
2: 0
3: 38
4: 295
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306043_1003306052 10 Left 1003306043 6:4930441-4930463 CCCTGCACCTGCACTGTGGCAGC 0: 1
1: 0
2: 0
3: 38
4: 295
Right 1003306052 6:4930474-4930496 GGAAAGGCGGGTGGACTGTTAGG 0: 1
1: 0
2: 0
3: 14
4: 141
1003306043_1003306048 -6 Left 1003306043 6:4930441-4930463 CCCTGCACCTGCACTGTGGCAGC 0: 1
1: 0
2: 0
3: 38
4: 295
Right 1003306048 6:4930458-4930480 GGCAGCTGCTTTCGGTGGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1003306043_1003306050 -2 Left 1003306043 6:4930441-4930463 CCCTGCACCTGCACTGTGGCAGC 0: 1
1: 0
2: 0
3: 38
4: 295
Right 1003306050 6:4930462-4930484 GCTGCTTTCGGTGGAAAGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 125
1003306043_1003306049 -3 Left 1003306043 6:4930441-4930463 CCCTGCACCTGCACTGTGGCAGC 0: 1
1: 0
2: 0
3: 38
4: 295
Right 1003306049 6:4930461-4930483 AGCTGCTTTCGGTGGAAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003306043 Original CRISPR GCTGCCACAGTGCAGGTGCA GGG (reversed) Intronic
900329462 1:2126809-2126831 CCTGCCACAATGCAGTGGCATGG - Intronic
900534461 1:3170213-3170235 GCAGCCAGGCTGCAGGTGCAGGG - Intronic
900915156 1:5632379-5632401 GCTGCCCCAGTGCTGGCACAGGG - Intergenic
900943935 1:5818965-5818987 GCAGCCACTGCGCATGTGCACGG + Intergenic
901086284 1:6614021-6614043 GCTGCGAGAGTGCAGGAGCTGGG - Exonic
901453993 1:9352938-9352960 GCTGCCACAGTTGAGCGGCAGGG + Intronic
902055296 1:13595713-13595735 CCTGCCACAGTGAATGGGCATGG + Intronic
902290846 1:15433698-15433720 GCTGCCTCTGGGCACGTGCATGG - Intergenic
902671091 1:17974359-17974381 GCTGGACCAGTGCAGCTGCAGGG + Intergenic
903009597 1:20320354-20320376 GCTGGCACAGGGCAGTGGCAAGG + Intronic
904033847 1:27548942-27548964 GCTGTCACAGCGCAGGGGCGTGG + Exonic
904366516 1:30014307-30014329 GCTCCATCAGAGCAGGTGCATGG + Intergenic
904439133 1:30518418-30518440 GCTGAGACAGTGTGGGTGCATGG - Intergenic
904718911 1:32491534-32491556 TGTGGCATAGTGCAGGTGCAAGG + Exonic
905878584 1:41449071-41449093 GCCCACACAGTGCAGGTGCTTGG + Intergenic
906688879 1:47779715-47779737 GCAGCCACAGGGCAGGCCCATGG - Intronic
910901509 1:92126330-92126352 GCTGCCACAGTGGTTGTACATGG + Intronic
912452230 1:109774197-109774219 GCAGGCACAGGGCAGGGGCAGGG + Intronic
913692178 1:121289547-121289569 GCTCCCACAGTGCAGGGGGGAGG + Intronic
914145377 1:144990567-144990589 GCTCCCACAGTGCAGGGGGGAGG - Intronic
914221970 1:145689415-145689437 GTTGCCCCATTGCAGGGGCAAGG + Intronic
915304269 1:154968894-154968916 GCTGCCACAGGGCTGGGGGAGGG + Intronic
918140659 1:181716965-181716987 ACTGCCACATTGCAGGTGTGGGG - Intronic
918477223 1:184937880-184937902 GCTGACCCACTGCAGGTGCAAGG + Intronic
919239136 1:194889333-194889355 GCTGCAACAGTGCATGGGCTTGG - Intergenic
920681887 1:208079326-208079348 GCTGGTACAGTGCTGGTGGAGGG + Exonic
920956564 1:210625029-210625051 GCTGCCACAGTTTAGGCCCATGG - Intronic
921495158 1:215830321-215830343 GCTGCCGCAGTGCAGCTCCTTGG - Intronic
922034120 1:221831810-221831832 GCTGCCACATTGCATGTAAAAGG - Intergenic
922322220 1:224498811-224498833 GCTGCAACAGTGCAGCAGAAAGG + Intronic
923336521 1:232975695-232975717 ACAGCCACTGGGCAGGTGCAAGG + Intronic
924564940 1:245189667-245189689 CCTGCCACAGAGAAGGCGCAAGG - Intronic
1062993948 10:1847504-1847526 GGGGCCTCTGTGCAGGTGCATGG - Intergenic
1063129986 10:3169958-3169980 GCTGCCACACAGCAGGAGCTGGG + Intronic
1063218326 10:3943839-3943861 GCAGAGACAGTGAAGGTGCAGGG + Intergenic
1065328544 10:24570846-24570868 GCTGCCAGTGTGAAGGTTCAGGG + Intergenic
1065973307 10:30822144-30822166 GCTGCCACTGGGCAGGGACAGGG - Intronic
1067851712 10:49758955-49758977 AGAGCCACAGGGCAGGTGCAGGG + Intronic
1070864913 10:79702495-79702517 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1070878702 10:79840627-79840649 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1071631807 10:87224716-87224738 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1071645261 10:87356937-87356959 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1072935856 10:99712666-99712688 GCTGCCACTCTACAGGTCCAGGG - Intronic
1073117788 10:101101814-101101836 GTTGCCACATTCCAGGTGAAAGG + Intronic
1073284682 10:102380564-102380586 TTTTCCACAGTGCAGATGCACGG + Exonic
1073429415 10:103476595-103476617 GCTGCAGCAGGGGAGGTGCAAGG + Intronic
1075962550 10:126581892-126581914 GCTGCCACTGTGCAGCAGTAAGG - Intronic
1076259924 10:129057389-129057411 GCTGCCACAGGGCAGCAGCCAGG - Intergenic
1076432203 10:130412188-130412210 GCTGGCACAGGGGAGGTGCGGGG - Intergenic
1076900599 10:133335745-133335767 GCCGCGACAGCGCAGGTGCAGGG - Intronic
1076942849 10:133621343-133621365 GCTGCCACAGGACAGGTGGTGGG - Intergenic
1077322001 11:1946879-1946901 GCTGCCAAAGGGCAGGGGCACGG + Intergenic
1077485429 11:2836314-2836336 ACACCCACAGAGCAGGTGCAGGG + Intronic
1077551971 11:3204451-3204473 GCTGACACATTCCAGGTGCAAGG - Intergenic
1079400778 11:20104694-20104716 GCTGCCACAGTGCAGAGGATTGG - Intronic
1081777061 11:45682945-45682967 GATGCCACACAGCAGGTCCAGGG - Intergenic
1083137318 11:60691581-60691603 GCTGCCACTGAGCAGCTCCAAGG + Intergenic
1083259526 11:61515666-61515688 GGTGCCAGAGGGCAGGTGCGGGG + Intronic
1083460437 11:62807382-62807404 GCTGCCACTGAGCCTGTGCAGGG - Exonic
1083712378 11:64557123-64557145 TCTGCCACTTTGCCGGTGCAGGG - Intronic
1083734611 11:64672259-64672281 CCTGCCACAGGGGAGGTGCATGG - Intronic
1084981596 11:72831848-72831870 GCAGCCACAGTCCAGCTGCAGGG - Intronic
1085722915 11:78929056-78929078 GCTGCCCAGCTGCAGGTGCAGGG - Intronic
1085982095 11:81737377-81737399 GCAGCCACAGGGCAGATCCAAGG + Intergenic
1087257166 11:95968971-95968993 GCTGCCAAAATGTAGGTTCAAGG + Intergenic
1088196014 11:107274568-107274590 AATGCCACAGTGCACATGCAGGG + Intergenic
1088902431 11:114128290-114128312 GCTGGCAGAGAGCAGGTGCCTGG - Intronic
1089063008 11:115641629-115641651 GCTGTCCCAGTCCAGGGGCAAGG - Intergenic
1089296788 11:117474094-117474116 CCTGGCACACTGCAGGTGCTTGG - Intronic
1090681620 11:129065308-129065330 CCTGCCACAGGCCATGTGCATGG - Intronic
1202805017 11_KI270721v1_random:2192-2214 GCTGCCAAAGGGCAGGGGCACGG + Intergenic
1092527305 12:9317109-9317131 GCTGCACCAGTGAAGGAGCAGGG + Intergenic
1092539971 12:9414664-9414686 GCTGCACCAGTGAAGGAGCAGGG - Intergenic
1096369979 12:51060969-51060991 GCTCCAACAGAGCAGGAGCAAGG + Intergenic
1098046407 12:66405472-66405494 GCTGCCACAGCTGTGGTGCAAGG - Intronic
1100673295 12:96839478-96839500 GCTGCAATAATGCAAGTGCAAGG + Intronic
1102566210 12:113799012-113799034 TCGGCCACAGTGCAGGGCCATGG + Intergenic
1103703111 12:122858220-122858242 GCTGGTACAGCGCAGGTGCAGGG - Exonic
1104292590 12:127483605-127483627 CCCGCTACAGTGCAGGTCCAGGG - Intergenic
1105411412 13:20174594-20174616 CATGCCACCGTGCAGGTGCGAGG - Intergenic
1106410444 13:29507636-29507658 GCTCCCACAGTGCAGGAGGAGGG - Intergenic
1110552247 13:76823007-76823029 GCTGCTCCACTGCAGGTGCTGGG - Intergenic
1111402609 13:87760989-87761011 GCTTCCACAGTGGATGTGTAAGG - Intergenic
1112312799 13:98334441-98334463 GCTGCCACCGTGATGGTGAAGGG - Intronic
1114957695 14:27845277-27845299 GCTCCCACAGTGCAGCGGCGGGG - Intergenic
1115285873 14:31712350-31712372 GCTGCCAGAGTGCCGGGGCTAGG - Intronic
1115652712 14:35414624-35414646 GCTGGCACAGTGTTGGTGCTCGG - Intergenic
1119934613 14:78580165-78580187 CCTGCCACAGAGAAGGAGCAAGG + Intronic
1120614726 14:86689045-86689067 TCTGCCACGGGGCAGGTACAAGG + Intergenic
1122016657 14:98802340-98802362 GAAGCCCCAGTGCAGGGGCAGGG + Intergenic
1122205154 14:100144667-100144689 GCTGCCTCAGGGCAGGGGCCTGG - Exonic
1126203431 15:46015221-46015243 GGTGCCACACTGCAGCTGCTTGG + Intergenic
1127272479 15:57413821-57413843 GCTGCCACAGGGCAACTGCTTGG + Intronic
1129824771 15:78627591-78627613 TCTGCCCCTGTGCAGCTGCATGG - Intronic
1129851384 15:78795808-78795830 GCACCCACAGGGCAGGAGCAGGG + Intronic
1130383516 15:83392242-83392264 CCTCCCTCAGTGCAGGTACAAGG + Intergenic
1131645595 15:94338720-94338742 GCTGCTTTAGTGCAGGTGCGGGG + Intronic
1132148547 15:99443337-99443359 GCAGCCTCAGGGCAGGTGCATGG - Intergenic
1134095260 16:11414638-11414660 GCTGCCACAGCGTGGGTGCTGGG + Intronic
1134556142 16:15167008-15167030 GCTGGCACAGAGAAGGTGCTTGG - Intergenic
1134916725 16:18078743-18078765 GCTGGCACAGAGAAGGTGCTTGG - Intergenic
1135757094 16:25107340-25107362 TCTGCCAGAGGGCAGGTGGATGG - Intergenic
1136612672 16:31376818-31376840 GCTGTCACATGTCAGGTGCAGGG - Exonic
1136993850 16:35174121-35174143 GCAGCCACTCTGCAGGTGCCTGG - Intergenic
1137386785 16:48049404-48049426 CCTGCCACTCTGCTGGTGCAGGG - Intergenic
1137485317 16:48885690-48885712 GCTGCCACAATGCATATGCATGG - Intergenic
1138337951 16:56267631-56267653 GCACCTACAGTACAGGTGCATGG - Intronic
1138544517 16:57707710-57707732 GCAGGCACAGTGCAGGTGATAGG + Intronic
1138782195 16:59802213-59802235 GCTGGCATAGGGCAGGTGAATGG + Intergenic
1139306186 16:65988152-65988174 GCTGGCATAGAGGAGGTGCAAGG + Intergenic
1140881236 16:79199885-79199907 GCAGCCAGAGGGCAGGGGCAGGG + Intronic
1140989487 16:80194950-80194972 GCAGCCACAGGGCAGGAGAAGGG - Intergenic
1141306461 16:82868838-82868860 GATGCCACAGTTCAGCTGCCTGG + Intronic
1142213320 16:88818818-88818840 GCTGCCATAGCGGAGATGCAGGG + Intronic
1142409905 16:89910741-89910763 GCTGGCACAGTCCTGGTTCAAGG - Intronic
1142472840 17:172740-172762 GCTGGCATAGAGCAGGTGCTTGG - Intronic
1143616293 17:8051997-8052019 GCCGGCACACTGCAGGTGCTTGG + Intergenic
1143703698 17:8681769-8681791 GCTGCCAAAGTTCAGATGCTGGG + Intergenic
1143848860 17:9794406-9794428 GCTGTCACAGGGCAGGGGCCTGG - Intronic
1143866370 17:9926602-9926624 GCTGGGCCAGGGCAGGTGCATGG - Intronic
1143963908 17:10742361-10742383 GATGCCACAGTCCAGGTACGAGG - Intergenic
1143964890 17:10750068-10750090 CTTGCGACAGTGCAGCTGCAGGG - Intergenic
1146893383 17:36523298-36523320 GCTGCCACACAGCTGTTGCATGG - Intronic
1147265930 17:39234684-39234706 CCTCCCAAAGTGCAGGTGCTGGG - Intergenic
1147390521 17:40106590-40106612 GCAGCCAATGGGCAGGTGCAGGG - Intergenic
1147458032 17:40550735-40550757 GGTGCCACGGTGGATGTGCAGGG + Intergenic
1147643764 17:42021251-42021273 TCTGTCACAGGGCAGGTGCTTGG - Intronic
1149754918 17:59178637-59178659 GCTGCCACAGGTGAGGTGGATGG + Intronic
1150302065 17:64055263-64055285 ACTGGCACAGAGCTGGTGCAGGG - Intronic
1150344474 17:64393734-64393756 GCAGCCATAATGTAGGTGCAAGG - Intronic
1151318424 17:73338056-73338078 CCAGCCACAGTGATGGTGCATGG + Exonic
1151458191 17:74239192-74239214 GCTGCCCCTCTCCAGGTGCAGGG + Intronic
1151732656 17:75920522-75920544 GCAGCCACAGATCAGATGCAGGG - Intronic
1152219110 17:79051187-79051209 TCTGCCACAAAGCAGGAGCAAGG - Intergenic
1153000129 18:447358-447380 GCTGCCACAGGGGAAGTGGAAGG - Intronic
1153223871 18:2883286-2883308 CCTGCCACAGGGCTGGTGCTTGG + Intronic
1153625200 18:7016610-7016632 CCTGCCACGCTGCAGTTGCAGGG + Exonic
1154217898 18:12428985-12429007 GCGGCCTGAGGGCAGGTGCAGGG + Intronic
1158544899 18:58387927-58387949 GCTGCCACGGTGGGGGTGGATGG - Intronic
1158610985 18:58940563-58940585 GCTGAGACAGTGCAGGTCCCAGG - Intronic
1159857835 18:73610536-73610558 GCTGGCACAGAGAAGGTGCTCGG - Intergenic
1160443992 18:78913338-78913360 CCTGCCACAGTGAAGGTCAAGGG - Intergenic
1160524557 18:79527257-79527279 ACGGCCAAAGTGCAGGTGCCAGG - Intronic
1160949342 19:1658090-1658112 GCTGCCTGTGGGCAGGTGCATGG - Intergenic
1161721731 19:5906403-5906425 CCTGGCACAGAGCAGGTGCTCGG - Intronic
1162562482 19:11425761-11425783 GCAGCCTCAGGGCAGGTGCAGGG + Intronic
1163267181 19:16228304-16228326 GAGGCCACAGTGAGGGTGCACGG - Intronic
1163636759 19:18440614-18440636 GCTGGCACAGGGCAGCTGGAGGG + Intergenic
1165110545 19:33499692-33499714 GCTGCTACAAGGCTGGTGCAAGG + Intronic
1165137501 19:33678958-33678980 CCTGGCACAGAGCAGGTGCTTGG - Intronic
1165857356 19:38887682-38887704 GGTGCCAAACTGCAGGTACAGGG + Intronic
1167500552 19:49844568-49844590 GATGCCACATTGCAACTGCAAGG - Intergenic
925060195 2:884981-885003 GCTGCCCCACTTCAGGTGCCAGG - Intergenic
925316840 2:2933107-2933129 GCGGCCACAGTGCAGGGCAAGGG - Intergenic
925413020 2:3650811-3650833 GCAGGCACAGTGAAGGCGCACGG + Intergenic
926373566 2:12204514-12204536 GTGGCAACTGTGCAGGTGCAAGG + Intergenic
926577759 2:14601083-14601105 GCTGGAACAGAGCAGGTGGAAGG + Intergenic
926795845 2:16618194-16618216 ACTGCCTCAGTGCAGGAGCAGGG + Intronic
928309031 2:30194579-30194601 GCTGCCCCAGTGTGGGTGCCCGG + Intergenic
929011117 2:37446064-37446086 GCTGGCAGAGTGCAGGGGCTGGG + Intergenic
929078762 2:38101045-38101067 TCTGCCACAGTGAAGGAGGAAGG + Intronic
931714490 2:65018456-65018478 CCAGCCACATTGCAGCTGCATGG + Intronic
933703460 2:85272863-85272885 GCAGCCACAGGGCAGGAGCGGGG + Intronic
936076397 2:109404447-109404469 GCAGCCACTCTGCAGGGGCAGGG + Intronic
936489471 2:112957855-112957877 GCTGGCACAGAGCAGGGGTAAGG - Intergenic
937360088 2:121223632-121223654 GATGCCACAATGTATGTGCACGG - Exonic
938182666 2:129196982-129197004 GCTGCCGGAGGGCAGGGGCAGGG + Intergenic
938195881 2:129327453-129327475 GCAGCCACTGTGCTGGGGCAAGG - Intergenic
938369890 2:130762388-130762410 GCTGCCACAGGGCAGCTGGTGGG + Exonic
939015885 2:136903533-136903555 GCTGCCACAGAGCAGGGGTATGG + Intronic
940453852 2:153872367-153872389 GCTGCCAGAGTGCCGGGGCTAGG + Intronic
947744087 2:232498712-232498734 GATGCAACAGTGCTGGTACAAGG - Intergenic
947757423 2:232577410-232577432 ACTGCCACTGTGCTGGTGCCTGG - Intronic
947806060 2:232968887-232968909 ACAGCCACAGTTCAGGTGGAGGG - Intronic
948079641 2:235195372-235195394 GCTGCGGCAGTGGTGGTGCATGG - Intergenic
948454876 2:238100304-238100326 GCTGCCACAGGGCAGATGGGAGG - Exonic
948846128 2:240683589-240683611 GGGGACACAGTGGAGGTGCAGGG - Intergenic
948847729 2:240691139-240691161 GGGGACACAGTGGAGGTGCAGGG + Intergenic
948945027 2:241215079-241215101 CCAGCCACAGGGCAGCTGCAGGG - Intronic
1170580621 20:17697058-17697080 CCTACCACAGTGCAGGTGTGAGG + Intronic
1171189536 20:23149442-23149464 GATGTCACGGTGTAGGTGCAGGG - Intergenic
1171316390 20:24199479-24199501 GCTGGCACAGTGGAGGGTCATGG - Intergenic
1171395105 20:24827832-24827854 GCTACCAGGGTGCAGGTGGAGGG - Intergenic
1171450818 20:25234926-25234948 GCTGCTAGAGTCCAGGGGCAGGG - Intergenic
1172425392 20:34852248-34852270 GCTGCCAAAGGGCTGGTTCAGGG + Exonic
1173812032 20:45961960-45961982 GCTGGCTCAGAGCAGGAGCACGG + Intronic
1174237175 20:49103386-49103408 GCTGCCTCAGGGGAAGTGCAGGG - Intergenic
1174563283 20:51446294-51446316 GCTCCCAGAGTGCAGGTAGAAGG + Intronic
1174672515 20:52321385-52321407 GCTGCCACAGTGTTGGTGCTTGG + Intergenic
1175150564 20:56930739-56930761 ACTTCCACAGTGCAGATTCACGG - Intergenic
1175159590 20:56998097-56998119 GTTGTCACAATGCAGGTGCTTGG + Intergenic
1175807797 20:61840198-61840220 GCTGTCCCAGTGCACGTGCACGG - Intronic
1175912747 20:62412596-62412618 GCTGGCATGGGGCAGGTGCAGGG - Intronic
1176261799 20:64185748-64185770 GTGGCCACAGTGCCAGTGCAAGG + Intronic
1176312421 21:5159431-5159453 GTTGCCACCGTGAAAGTGCATGG - Intergenic
1178155560 21:29849762-29849784 GCTGGCACATTTCAAGTGCATGG + Intronic
1179142086 21:38734482-38734504 GCAGCCGCGGTGCAGGCGCAGGG + Intergenic
1179418539 21:41217542-41217564 GCTGCCACAGGGAAGGCACAGGG - Intronic
1179825948 21:43966604-43966626 GCAGACAGCGTGCAGGTGCAGGG - Intronic
1179844627 21:44102599-44102621 GTTGCCACCGTGAAAGTGCATGG + Intronic
1180157345 21:45983986-45984008 GCTGCCCCACTGCAGGCCCAAGG + Intronic
1180704324 22:17799601-17799623 GCTGCCCCAGGCCAGGAGCATGG - Intronic
1181462010 22:23091266-23091288 TCTGTGAGAGTGCAGGTGCATGG - Intronic
1181882816 22:25994612-25994634 GCTGCCAAACTGCTGGTGAAAGG + Intronic
1182280558 22:29215676-29215698 GGTGCCTCCCTGCAGGTGCATGG + Intronic
1182511966 22:30826322-30826344 GAGGCCACTCTGCAGGTGCAGGG - Intronic
1182857941 22:33534686-33534708 GCTGCCCCAGTGCTGGTTCTGGG + Intronic
1183064457 22:35353543-35353565 GGTACCCCAGGGCAGGTGCAAGG - Intergenic
1183751590 22:39724061-39724083 CCTCCCACAGTGTAGGTGCTTGG + Intergenic
1184636671 22:45837700-45837722 GCTGTCACACTGCAAGGGCAGGG - Intronic
1184833036 22:47002699-47002721 GGTGCCACAGTGGTGGTGCCAGG + Intronic
950869260 3:16214569-16214591 CCTGGCACAGAGCAGGTGCTTGG - Intronic
953793472 3:45965902-45965924 GCTGCCACAGGGCGGGGGCAAGG + Intronic
953920222 3:46946635-46946657 GCTACCACAGTGCCCGTTCAGGG - Intronic
953977875 3:47395933-47395955 CCTGCCAGAGTGTTGGTGCAGGG + Intronic
954117564 3:48475636-48475658 ACTGCCACAGTGCAGGGGAAAGG - Intronic
954698386 3:52439492-52439514 TCTGCCACAGCGGAGGTGCGGGG + Intronic
955522970 3:59792982-59793004 GCAGTCACAGTGCAGGCGGATGG - Intronic
955523939 3:59802077-59802099 GCTGCCACATGGCAGGTGCCAGG + Intronic
956080130 3:65549046-65549068 GCGGCGCCAGGGCAGGTGCAAGG - Intronic
956219167 3:66883886-66883908 CTTGGCACAGTGCAGCTGCATGG + Intergenic
957270946 3:78029855-78029877 GCCGCCACAGCGCAGCGGCAGGG - Intergenic
961951162 3:130750845-130750867 ACTGCCAAAATGCAGCTGCAAGG - Intergenic
962271080 3:133978564-133978586 GCTGCCACAGGACAGGGGCCCGG + Intronic
963044740 3:141094287-141094309 GCCGGCTCAGAGCAGGTGCATGG + Intronic
964717008 3:159732957-159732979 GCTGCCACAGAGCAGGAGGTGGG + Intronic
966916805 3:184588869-184588891 GATGCCACAGTCTAGGTGAAGGG + Intronic
968708134 4:2093197-2093219 GCTGCCCCACGGCAGGTGCTCGG + Intronic
968748603 4:2374189-2374211 GCAGCCAGAGTGCAAGTACACGG + Intronic
968971927 4:3800370-3800392 TATGCCCCAGTCCAGGTGCAGGG + Intergenic
969206075 4:5647084-5647106 GGTGACACAGGTCAGGTGCAGGG - Intronic
969718090 4:8877977-8877999 CCTGGCACAGGGCAGGTGCTGGG - Intergenic
970096737 4:12472107-12472129 CCAGGCACAGAGCAGGTGCAAGG - Intergenic
970200764 4:13602221-13602243 TCTGCCTCAATGCTGGTGCAAGG + Exonic
971197167 4:24480619-24480641 TCTGCCACAGAGCAGGTGACAGG + Intergenic
973683723 4:53347865-53347887 CCAGCAACACTGCAGGTGCAGGG + Intronic
980225930 4:129985676-129985698 CCTGCCACAGGGCAGCTGGAAGG + Intergenic
981750639 4:148090142-148090164 CCTGGCACAGAGCAGGTGCTCGG - Intronic
984812846 4:183810186-183810208 GCTGCCACCTTGCAGTTGCAGGG + Intergenic
988353466 5:30142614-30142636 TCTGCCACCCTCCAGGTGCATGG + Intergenic
988684546 5:33514427-33514449 CCTGCCACAGTGCATGGACAGGG + Intergenic
991776640 5:70091658-70091680 GCTGACACACTGAAGGGGCAAGG + Intergenic
991855927 5:70967105-70967127 GCTGACACACTGAAGGGGCAAGG + Intergenic
991869942 5:71099878-71099900 GCTGACACACTGAAGGGGCAAGG + Intergenic
994828056 5:104742065-104742087 GCTGTCAAAGTGCAAATGCATGG - Intergenic
995784685 5:115816031-115816053 GCGGCCACAGCGCAGGCGGAAGG - Intronic
996298616 5:121954393-121954415 GCTCCCACAGTGCAGCGGCCGGG + Intergenic
997716643 5:136047699-136047721 GAAGCCACAGTGCAGGTCCAGGG - Intronic
998253508 5:140568116-140568138 GCTGCCATAGTACAGGCGCATGG - Exonic
998556385 5:143128600-143128622 GCTTCCACTGTGAAGGTGCTGGG + Intronic
1000627422 5:163555183-163555205 GCTGCCATAAAGCAGGTGCTTGG + Intergenic
1000873567 5:166606820-166606842 GCTGCCATGATGCAGGGGCATGG + Intergenic
1001155776 5:169271498-169271520 GGGGCCACGGTGCTGGTGCACGG + Intronic
1001331922 5:170768146-170768168 GCTGCCACAGTTCAGATGCTCGG - Intronic
1001450318 5:171819531-171819553 ACTAACACAGTTCAGGTGCATGG + Intergenic
1002560708 5:180080166-180080188 GCTTCCTCAGCCCAGGTGCATGG - Intergenic
1002884100 6:1278571-1278593 CCTGCCACAGTGGAGGAGGAGGG + Intergenic
1003171802 6:3726282-3726304 GCTGGCACCGTGGAGGTACAAGG - Intronic
1003306043 6:4930441-4930463 GCTGCCACAGTGCAGGTGCAGGG - Intronic
1005661498 6:28003242-28003264 GTTGACACTGTGCAGGTGCGTGG + Intergenic
1006077309 6:31542056-31542078 GCTGCAAGAGCGCAGGCGCAAGG + Exonic
1006417781 6:33914943-33914965 GCAGCCACTGTGGAGGGGCAGGG - Intergenic
1007213352 6:40216300-40216322 GCTGCCAAAGTGCATGAGCTAGG - Intergenic
1007251535 6:40498465-40498487 GCAGCCACAGTGCAGGTGACTGG - Intronic
1008882352 6:56394118-56394140 GCAGCCACAATGCAGGAGCTGGG + Intergenic
1009307051 6:62103425-62103447 GCTGCCACAGTGCCTGGGCTTGG + Intronic
1009624765 6:66125758-66125780 GCAGCCACAGTGCTAGTGAAGGG - Intergenic
1010462782 6:76132377-76132399 GATGCCACAGTGCAGGGCCCAGG - Intergenic
1012611999 6:101229067-101229089 CCCCCCACAGTGCAGGTCCAGGG + Intergenic
1014733864 6:125068252-125068274 GCTGCAACAGGGCTAGTGCAGGG + Intronic
1017066610 6:150534953-150534975 GCTGCCACAAAGCAGGTGGAGGG + Intergenic
1017298923 6:152834263-152834285 GCTCCCACAGTGCAGTGGGAGGG - Intergenic
1018446524 6:163863695-163863717 TCTGCCACCCTGCAGGTGCAGGG + Intergenic
1018778564 6:167042540-167042562 GCTGGCACAGCTCTGGTGCATGG - Exonic
1019287130 7:229218-229240 GCTGCCTCATTGCACGTGGAAGG - Exonic
1019388033 7:769487-769509 GCAGCCACGGTGCAGGAGCTTGG + Intronic
1019487421 7:1295812-1295834 GGTGCCACAGCCCAGGTCCAGGG - Intergenic
1019488498 7:1300356-1300378 GCCGCAACACTGCAGGTGGAGGG - Intergenic
1019644304 7:2120919-2120941 CCTGCCCTAGAGCAGGTGCAGGG - Intronic
1020550400 7:9596803-9596825 GCTGCCACAGGGCTGGGGCTTGG - Intergenic
1021677587 7:23097100-23097122 TCTGCCCCAGAGCAGGTGCTGGG - Intergenic
1022648274 7:32251637-32251659 CCAGGCACTGTGCAGGTGCAGGG - Intronic
1023964444 7:44955658-44955680 GCTCCCACAGAGCAGGGGCTGGG - Intergenic
1024544949 7:50509172-50509194 GCTGGTACGGTGCCGGTGCATGG + Intronic
1024670099 7:51586389-51586411 GCTGCCCCAGTGCAGGTGAGAGG + Intergenic
1026614277 7:71887715-71887737 GCAGCCACAGTGCAGGAGAGAGG + Intronic
1028850168 7:95528910-95528932 GCTCCCACAGTGCCAGTGCCAGG + Intronic
1029257072 7:99276677-99276699 GCTGACACAGTGCAGGAGGAGGG + Intergenic
1029381061 7:100214974-100214996 ACTGCCACAGTGCAGCCTCAGGG + Intronic
1029400437 7:100341923-100341945 ACTGCCACAGTGCAGCCTCAGGG + Intronic
1030064445 7:105648643-105648665 GCAGCCACAGTGCAGTCACAGGG + Intronic
1030395781 7:108984695-108984717 GCTTCCTCAGTGCAGTTGTAAGG + Intergenic
1032279935 7:130492105-130492127 GCTGCCGCAGAGGAGGTGCCGGG - Exonic
1035289675 7:157829905-157829927 GCTGCCACTGCAGAGGTGCAGGG - Intronic
1035370007 7:158373765-158373787 GCTGCTACTCTGCAGGTGCATGG - Intronic
1035915959 8:3622738-3622760 GCTGACACACTGTATGTGCAAGG + Intronic
1037754534 8:21702528-21702550 ACAGCCTCGGTGCAGGTGCAGGG - Intronic
1039899299 8:41740045-41740067 GCTGCCACAGAGAAGGGGGAAGG - Intronic
1041170908 8:55141341-55141363 GCGGCCACAGTTGAGGGGCACGG - Intronic
1041457302 8:58074701-58074723 GGTGCTACAGTGCAGATGAACGG + Intronic
1043526247 8:81099496-81099518 CATGCTACAGTGCAGGTTCAGGG - Intronic
1044539765 8:93395396-93395418 GCTGCCCCTGTGCAGGATCAGGG - Intergenic
1045864520 8:106850103-106850125 GGTGCCACAATTCAGGTGCGAGG - Intergenic
1046265455 8:111823723-111823745 GCTCCCACAGTGCAGTTGGTGGG + Intergenic
1046299517 8:112269026-112269048 ATTGTCACAGTGCAGGGGCAGGG - Intronic
1046497709 8:115036627-115036649 GCTCCCACAGTGCAGCGGCAGGG - Intergenic
1046958906 8:120089154-120089176 GAGGCCACAGTGCAGGTGTCAGG + Intronic
1047926917 8:129691200-129691222 GCTGGAACAGTGGAGGTGGATGG + Intergenic
1057006644 9:91566666-91566688 TCTGCCACAGTCAAGGAGCAAGG - Intronic
1057264372 9:93604205-93604227 GGTGGCATAGTGCAGGTGCCGGG + Intronic
1057291709 9:93810936-93810958 GCTGCAACATTGAAGGTGCAGGG + Intergenic
1057302934 9:93896860-93896882 GCCCTCACAGTGCAGGTGCCCGG - Intergenic
1057321246 9:94015022-94015044 GCTGCCAGAGGGCAGCTGCCGGG - Intergenic
1057482830 9:95459159-95459181 TTTGACACAGTGCAGGTGCTTGG + Intronic
1058577060 9:106415190-106415212 GCTGACACTGAGCAGGTGTATGG - Intergenic
1058662788 9:107282290-107282312 CCTGGCACATTGCAGGTGCACGG - Intergenic
1059340674 9:113595817-113595839 GCTGCCACCTTGCAGCTGAAGGG - Intronic
1060332131 9:122682819-122682841 GCTGCCACTGTGCTGCTTCAAGG + Intergenic
1060790193 9:126480714-126480736 GCTGGCACAGAGCAGGTGCTTGG - Intronic
1060836971 9:126763388-126763410 GAGGCCACAGTGCAGGAGCACGG - Intergenic
1062533546 9:137011892-137011914 GCTGACAAACTGCAGGTGCTTGG + Exonic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1062730106 9:138103928-138103950 GCAGGCACAATGCAGGGGCAGGG - Intronic
1186311808 X:8328192-8328214 GCTTCCACAGGGATGGTGCAGGG - Intergenic
1187473315 X:19588451-19588473 CCTGCCTGAGTGCAGGAGCAAGG + Intronic
1189358427 X:40329086-40329108 GCTGCCATAGTGAAGAAGCATGG + Intergenic
1190291414 X:48995240-48995262 GCTGGCCCAGGGCAGATGCAGGG + Intronic
1193978192 X:88149767-88149789 ACTGCCACAGTGCATCTGGAAGG - Intergenic
1194542889 X:95196580-95196602 CCTGCCAAAGTGAAGGAGCATGG - Intergenic
1198594416 X:138220710-138220732 GCTGCCACAGTTTAGGTGGCAGG - Intergenic
1199466991 X:148149270-148149292 GTTGCAACAGTGCATGGGCAGGG - Intergenic
1200611152 Y:5328282-5328304 GCTGCTACAGTTCAGGTGTTTGG + Intronic
1201301603 Y:12509927-12509949 GCTGTCACAGTTCTGGAGCACGG - Intergenic
1201469118 Y:14314672-14314694 GCTGCCTCTTTGCAGGAGCAGGG + Intergenic