ID: 1003306044

View in Genome Browser
Species Human (GRCh38)
Location 6:4930442-4930464
Sequence AGCTGCCACAGTGCAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 988
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 916}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003306044_1003306051 0 Left 1003306044 6:4930442-4930464 CCTGCACCTGCACTGTGGCAGCT 0: 1
1: 0
2: 2
3: 69
4: 916
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306044_1003306048 -7 Left 1003306044 6:4930442-4930464 CCTGCACCTGCACTGTGGCAGCT 0: 1
1: 0
2: 2
3: 69
4: 916
Right 1003306048 6:4930458-4930480 GGCAGCTGCTTTCGGTGGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1003306044_1003306049 -4 Left 1003306044 6:4930442-4930464 CCTGCACCTGCACTGTGGCAGCT 0: 1
1: 0
2: 2
3: 69
4: 916
Right 1003306049 6:4930461-4930483 AGCTGCTTTCGGTGGAAAGGCGG No data
1003306044_1003306050 -3 Left 1003306044 6:4930442-4930464 CCTGCACCTGCACTGTGGCAGCT 0: 1
1: 0
2: 2
3: 69
4: 916
Right 1003306050 6:4930462-4930484 GCTGCTTTCGGTGGAAAGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 125
1003306044_1003306052 9 Left 1003306044 6:4930442-4930464 CCTGCACCTGCACTGTGGCAGCT 0: 1
1: 0
2: 2
3: 69
4: 916
Right 1003306052 6:4930474-4930496 GGAAAGGCGGGTGGACTGTTAGG 0: 1
1: 0
2: 0
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003306044 Original CRISPR AGCTGCCACAGTGCAGGTGC AGG (reversed) Intronic
900184363 1:1325948-1325970 AGGTTCCCCAGAGCAGGTGCGGG + Intronic
900463614 1:2813192-2813214 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
900534462 1:3170214-3170236 AGCAGCCAGGCTGCAGGTGCAGG - Intronic
900568718 1:3347930-3347952 AGCAGCCCCAGAGCTGGTGCCGG + Intronic
901046035 1:6396170-6396192 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
901086285 1:6614022-6614044 GGCTGCGAGAGTGCAGGAGCTGG - Exonic
901833237 1:11906865-11906887 AGCTGCTACAGGGCAGAGGCTGG + Intergenic
902032683 1:13434290-13434312 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
902033382 1:13439203-13439225 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
902575078 1:17372546-17372568 AGCTGCTACAGGGCAGAGGCAGG - Intronic
902671090 1:17974358-17974380 AGCTGGACCAGTGCAGCTGCAGG + Intergenic
902697602 1:18150772-18150794 AACTGCCCCAGTGAAAGTGCTGG - Intronic
903358670 1:22763429-22763451 AGCTGAGGCAGGGCAGGTGCTGG - Intronic
903478803 1:23638331-23638353 AGCTGCCACTGTGGAGGGACAGG + Intronic
903603990 1:24561562-24561584 AGCTTCCACAGTGAAGGGCCTGG - Intronic
904117607 1:28174175-28174197 AGCTCCCAAAGGGCAAGTGCTGG - Intronic
904119211 1:28185232-28185254 GCCTGGCACATTGCAGGTGCTGG + Intronic
904238939 1:29131519-29131541 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
904732801 1:32607313-32607335 CTCTGCAACAGAGCAGGTGCAGG + Intronic
905688011 1:39922568-39922590 GGCTCGCACAATGCAGGTGCCGG - Intergenic
905795063 1:40811252-40811274 AGCGGCCACAGGGCAGGAGGGGG - Intronic
906480459 1:46196071-46196093 CTCTGCCACTGTGTAGGTGCTGG - Exonic
906914715 1:49995804-49995826 ACCTGCACCAGAGCAGGTGCTGG + Intronic
907979997 1:59472047-59472069 GGCTCCCACAGTGCAGCGGCGGG - Intronic
908418230 1:63934024-63934046 AGCTGCTGCTTTGCAGGTGCAGG + Intronic
908837504 1:68242684-68242706 AGCTGTCACAGTGCTGCTCCTGG + Intergenic
909318613 1:74253789-74253811 GGCTCCCACAGTGCAGCAGCGGG + Intronic
909608787 1:77532165-77532187 GGCTCCCACAGTGCAGCGGCGGG + Intronic
910334277 1:86110478-86110500 GCCTTCCACAGTGCAGGGGCAGG - Intronic
910637507 1:89425413-89425435 TGTTGACACTGTGCAGGTGCTGG + Intergenic
910693195 1:89985059-89985081 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
911001395 1:93170187-93170209 GGCTCCCACAGTGCAGCGGCGGG - Intronic
912022845 1:105127628-105127650 AGCTTCCAAAGGGCAGCTGCAGG - Intergenic
913178708 1:116298429-116298451 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
914933387 1:151955307-151955329 GGCTCCCAAAGTGCAGGTACAGG - Intergenic
915666172 1:157446722-157446744 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
915734360 1:158075355-158075377 AGCTCCCACAGTGAAGGAGGCGG + Intronic
915828887 1:159106329-159106351 AGCAGCCACTGTGAAGATGCTGG - Intronic
916606105 1:166343473-166343495 GGCTCCCACAGTGCAGCTGGGGG + Intergenic
916938979 1:169661135-169661157 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
917348927 1:174056808-174056830 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
918002184 1:180508520-180508542 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
918140660 1:181716966-181716988 GACTGCCACATTGCAGGTGTGGG - Intronic
918344010 1:183590692-183590714 AGCTGCCACAGAACAGGGGTGGG - Intronic
918708882 1:187703536-187703558 GGCTTCCACAGTGCAGCGGCGGG - Intergenic
918789908 1:188813006-188813028 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
918793121 1:188857548-188857570 GACTCCCACAGTGCAGCTGCAGG - Intergenic
918943037 1:191026436-191026458 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
919091838 1:192986830-192986852 GGCTGCCACAGTGCAGCGGTGGG - Intergenic
919185566 1:194143252-194143274 AGAAGCTATAGTGCAGGTGCAGG + Intergenic
919297827 1:195723330-195723352 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
919630899 1:199959592-199959614 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
919755529 1:201063842-201063864 AGCTGCCACTGGGCAGGGTCTGG + Intronic
919830754 1:201538924-201538946 AACTGGCACAGTGCAGGGGGAGG + Intergenic
920381391 1:205536506-205536528 AGCTGCCTCCGGGCAGGTGTGGG + Intergenic
920479503 1:206307894-206307916 GGCTCCCACAGTGCAGGGGGGGG + Intronic
920604926 1:207371837-207371859 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
920878518 1:209859092-209859114 AGCTCCCACAGTGCAGCGGTGGG + Intergenic
921096225 1:211889467-211889489 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
922024680 1:221739490-221739512 GGTTGCCACAGTGCAGCAGCTGG + Exonic
922307034 1:224352926-224352948 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
922417013 1:225431284-225431306 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
922546793 1:226464116-226464138 GGCTCCCACAATGCAGCTGCGGG - Intergenic
922824977 1:228511657-228511679 CGAGGCCACTGTGCAGGTGCAGG - Intergenic
922985816 1:229865377-229865399 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
923172657 1:231431215-231431237 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
923193510 1:231642347-231642369 GGCTCCCACAGTGCAGCGGCGGG + Intronic
923386011 1:233465951-233465973 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
923596055 1:235361511-235361533 AGCTTCCACAGTGTTGCTGCTGG - Intergenic
923637503 1:235714733-235714755 AGCTACCACAGTGAAGTTGCCGG + Intronic
923698891 1:236281720-236281742 AGCGGCCGCGGTGCAGCTGCTGG - Exonic
923810567 1:237310053-237310075 GGCTCCCACAGTGCAGCAGCAGG + Intronic
924034848 1:239925210-239925232 GGCTCCCACAGTGCAGTAGCAGG + Intergenic
924577822 1:245296471-245296493 AGGTGCCACCGGGCAGCTGCTGG + Intronic
1063129985 10:3169957-3169979 AGCTGCCACACAGCAGGAGCTGG + Intronic
1063322231 10:5061083-5061105 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1063769632 10:9183268-9183290 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
1064086840 10:12351466-12351488 GGCGGCCACAGTGCGGGTCCTGG - Intronic
1064437302 10:15322462-15322484 TGCTGCTACAGTTCAGGTGAGGG - Intronic
1064449273 10:15426517-15426539 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1064460965 10:15534888-15534910 GGCTCCCACAGTGCAGCCGCGGG - Intronic
1065802547 10:29366113-29366135 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1065895835 10:30162773-30162795 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1065995441 10:31055743-31055765 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1066590619 10:36989731-36989753 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1066615121 10:37285608-37285630 GGCTCCCACAGTGCAGCAGCAGG + Intronic
1066648446 10:37634389-37634411 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1067052094 10:43027635-43027657 AGCTGCCACAATGCCTGTGTTGG + Intergenic
1067183213 10:44005916-44005938 ACCAGCCACAGAGCAGATGCCGG - Intergenic
1067711137 10:48652038-48652060 AGCTGCCATAGTTCAGGGGTGGG + Intronic
1068211274 10:53924101-53924123 GGCTCCCACAGTGCAGCCGCGGG - Intronic
1068211378 10:53924506-53924528 AGGTGCCACAGAGCAGGGGGTGG - Intronic
1068555018 10:58448697-58448719 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1069557218 10:69406363-69406385 AGGTGCCCCAGAGCAAGTGCAGG + Intronic
1069988616 10:72300527-72300549 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1070864914 10:79702496-79702518 AGCGGCCACACTGCAGGGGCAGG - Intergenic
1070878703 10:79840628-79840650 AGCGGCCACACTGCAGGGGCAGG - Intergenic
1070942619 10:80359925-80359947 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1071055645 10:81505745-81505767 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1071332125 10:84571119-84571141 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1071439750 10:85679846-85679868 GGCTGCCTCAGGGCAGGCGCTGG - Intronic
1071631808 10:87224717-87224739 AGCGGCCACACTGCAGGGGCAGG - Intergenic
1071645262 10:87356938-87356960 AGCGGCCACACTGCAGGGGCAGG - Intergenic
1071797122 10:89019017-89019039 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1071901045 10:90120217-90120239 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1072468873 10:95693556-95693578 AGCTGCCACAAAGCAGGAGTGGG - Intronic
1072679669 10:97498201-97498223 AGCGGCCTCAGTACAGGCGCCGG - Intronic
1073262551 10:102201310-102201332 GGCTCCCATAGTGCAGCTGCAGG + Intergenic
1073439797 10:103545625-103545647 AGCTGGCATAGTGCAGTGGCTGG + Intronic
1073532452 10:104245093-104245115 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1073878254 10:107950498-107950520 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1074314529 10:112349663-112349685 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1074732418 10:116393323-116393345 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1074996412 10:118760589-118760611 GGCTCCCACAGTGCAGCCGCGGG + Intergenic
1076261721 10:129071793-129071815 AGCTCCCACAGTGCAGCGGTGGG + Intergenic
1076432204 10:130412189-130412211 GGCTGGCACAGGGGAGGTGCGGG - Intergenic
1076585970 10:131547864-131547886 AGGTGGCACAGTGCAGAAGCTGG - Intergenic
1076791267 10:132777961-132777983 TGCTGCCCCAGCCCAGGTGCTGG - Intronic
1076900600 10:133335746-133335768 TGCCGCGACAGCGCAGGTGCAGG - Intronic
1076942850 10:133621344-133621366 TGCTGCCACAGGACAGGTGGTGG - Intergenic
1076945051 10:133640809-133640831 AGCGGCCACAGCGAAGGCGCTGG - Intergenic
1077764530 11:5144333-5144355 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1077778263 11:5294831-5294853 GGCTCCCACAGTGCAGCGGCCGG + Intronic
1078599928 11:12721209-12721231 ACCTGGCTCAGTGCAGGTGCAGG + Intronic
1078682195 11:13487335-13487357 GGCCGCCACAGTGCAGCCGCGGG + Intergenic
1079756859 11:24274681-24274703 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1080138802 11:28890661-28890683 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
1080204360 11:29712563-29712585 GGCTCCTACAGTGCAGGGGCAGG - Intergenic
1080223471 11:29934132-29934154 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1080638721 11:34145862-34145884 AGCTGGCTCAGGGCAGGAGCTGG + Intronic
1081046464 11:38279042-38279064 GTCTGCCACAGTGCAGCAGCGGG + Intergenic
1081177277 11:39944839-39944861 AGCAGCCACAGTCCTGGGGCAGG + Intergenic
1081324520 11:41728525-41728547 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1082912385 11:58391013-58391035 GGCTCCCACAGTGCAGCGGCCGG + Intergenic
1082924577 11:58531868-58531890 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1083074354 11:60020658-60020680 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1083202931 11:61131316-61131338 CCCTGCCACAGTGCATGGGCAGG + Exonic
1083259525 11:61515665-61515687 TGGTGCCAGAGGGCAGGTGCGGG + Intronic
1083934506 11:65863286-65863308 GGCAGCCACAGTTCAGCTGCAGG - Intronic
1083954767 11:65977239-65977261 AGATGCCACAGTGGAGGGGAAGG - Intronic
1084024810 11:66441175-66441197 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1084186589 11:67476011-67476033 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1084402882 11:68955546-68955568 AAAGGACACAGTGCAGGTGCAGG - Intergenic
1084566231 11:69930613-69930635 AGCTGCCACCGTGGAGGCGGTGG - Intergenic
1084981597 11:72831849-72831871 TGCAGCCACAGTCCAGCTGCAGG - Intronic
1085037115 11:73307519-73307541 AGCCGCCAGACTGCAGGGGCAGG + Intergenic
1085384924 11:76152083-76152105 AGCTCCCACGGGGCAGGCGCGGG + Intergenic
1085447307 11:76609471-76609493 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1085671139 11:78465344-78465366 GGCTCCCACAGTGCAGTGGCAGG + Intronic
1085722916 11:78929057-78929079 AGCTGCCCAGCTGCAGGTGCAGG - Intronic
1085833346 11:79926875-79926897 AGCAGACACAGTGCAGGAACAGG - Intergenic
1085863066 11:80257481-80257503 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1085982862 11:81744968-81744990 GGCTCCCACAGTGCAGCTGTGGG + Intergenic
1086001666 11:81991319-81991341 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1086200424 11:84195027-84195049 GGCTCCCACAGTGCAGTGGCGGG + Intronic
1086210179 11:84308977-84308999 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1086397808 11:86433963-86433985 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1086724586 11:90167110-90167132 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1090083134 11:123627533-123627555 AGATGGCCCAGTGCAGGTGTTGG - Intronic
1090133617 11:124171139-124171161 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1090226395 11:125074598-125074620 AGTTGACACAGTGCAGTTGGGGG + Intronic
1090820580 11:130337801-130337823 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1090829879 11:130413929-130413951 GGCTGCCTCAGGGCTGGTGCAGG - Intronic
1090910978 11:131118980-131119002 ATCTGCCAGAGGCCAGGTGCGGG - Intergenic
1091169380 11:133506854-133506876 AGCTGGCCCTGTGCAGGTTCGGG + Intronic
1092101748 12:5889289-5889311 GGCTCCCACAGTGCAGCAGCAGG + Intronic
1092545916 12:9450826-9450848 GGCTCCTACAGTGCAGCTGCGGG + Intergenic
1092834268 12:12472842-12472864 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1092990719 12:13896271-13896293 AGCTGACAAAGCGAAGGTGCAGG + Intronic
1093346212 12:18040173-18040195 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
1093524836 12:20093705-20093727 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1093527150 12:20115671-20115693 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1093715451 12:22376823-22376845 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1093921604 12:24865995-24866017 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1093972896 12:25391347-25391369 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1094108728 12:26839097-26839119 GGCTCCCACAGTGCAGCGGCTGG - Intergenic
1094405417 12:30110890-30110912 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1094507040 12:31071247-31071269 GGCTCCTACAGTGCAGCTGCGGG - Intergenic
1095304098 12:40620599-40620621 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1095478663 12:42611219-42611241 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1095642323 12:44500316-44500338 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1097212884 12:57386231-57386253 AGCTCCCACAGTGCAGCGGTGGG - Intronic
1097678990 12:62631936-62631958 TCCTGCCACAGTGCCGGAGCGGG + Intergenic
1097863707 12:64542850-64542872 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1097924573 12:65113015-65113037 AGCTCCCAGAGGGCAGGTACTGG + Intronic
1097981951 12:65744278-65744300 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1098168279 12:67719673-67719695 AGCTCCCACAGTGCAGCGGTGGG + Intergenic
1098498828 12:71166649-71166671 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1099192386 12:79573837-79573859 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1099559679 12:84155562-84155584 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1099716288 12:86296834-86296856 GGCTCCCACAGTGCAGTGGCGGG + Intronic
1100247561 12:92777566-92777588 AACTGCAGCAGTGCAGGAGCTGG - Exonic
1100600581 12:96108823-96108845 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1100734682 12:97513179-97513201 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1102387299 12:112520331-112520353 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1102508473 12:113398712-113398734 AGGTGCCACAGTCAAGGTGGTGG - Exonic
1103063285 12:117876050-117876072 AGCGGGCACAGTGCACCTGCAGG + Intronic
1103439298 12:120950785-120950807 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1103459717 12:121093949-121093971 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1103497500 12:121374383-121374405 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1103668482 12:122591943-122591965 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1103678776 12:122677039-122677061 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1103703112 12:122858221-122858243 AGCTGGTACAGCGCAGGTGCAGG - Exonic
1103760931 12:123249713-123249735 GGCTTCCACAGTGCAGCGGCGGG + Intronic
1104317830 12:127720668-127720690 AGCTGAAACAGTGGAGCTGCTGG - Intergenic
1104355530 12:128081799-128081821 GGCTGCCAAATTGCAGGTCCTGG + Intergenic
1104373818 12:128247166-128247188 GGCTCCCACAGTGCAGCTGCAGG - Intergenic
1105320335 13:19314130-19314152 AGCTGCCAGAGTTCTTGTGCTGG + Intergenic
1105477444 13:20740370-20740392 GGCTCCCACAGTGCAGCAGCAGG + Intronic
1105602873 13:21902646-21902668 AGCTTACACAGAGCAGGGGCTGG - Intergenic
1105605217 13:21921098-21921120 GGCTCCCACAGTGCAGGGGCGGG + Intergenic
1105697281 13:22900846-22900868 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1105701592 13:22939079-22939101 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1105871196 13:24507229-24507251 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1105876748 13:24561147-24561169 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1106410445 13:29507637-29507659 TGCTCCCACAGTGCAGGAGGAGG - Intergenic
1106600612 13:31183450-31183472 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1107927695 13:45279207-45279229 ACCTGGCACATTGTAGGTGCTGG + Intronic
1108362355 13:49678720-49678742 GGCTCCCACAGTGCAGCCGCGGG + Intronic
1108644042 13:52408522-52408544 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1108686678 13:52826192-52826214 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1108751594 13:53452834-53452856 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1108991195 13:56659551-56659573 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1108995951 13:56735528-56735550 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1109124759 13:58504668-58504690 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1109124982 13:58505862-58505884 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1109145347 13:58773236-58773258 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1109563222 13:64077936-64077958 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1109699638 13:66009303-66009325 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1109741474 13:66560984-66561006 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1109830007 13:67773359-67773381 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1109858766 13:68170898-68170920 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1109869891 13:68321061-68321083 CCCAGCCACAGTGCAGGTGAGGG + Intergenic
1110440134 13:75518472-75518494 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1110497805 13:76190033-76190055 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1110552248 13:76823008-76823030 AGCTGCTCCACTGCAGGTGCTGG - Intergenic
1110609878 13:77475896-77475918 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1110862070 13:80355465-80355487 GGCTCCCACAGTGCAGGGGTGGG - Intergenic
1110913990 13:80998869-80998891 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1110999904 13:82165392-82165414 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1111220847 13:85204832-85204854 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
1111528737 13:89509048-89509070 AGAGGCCACTGAGCAGGTGCTGG - Intergenic
1111590961 13:90348519-90348541 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1112282746 13:98076714-98076736 GGCTCCCACAGTGCAGAGGCGGG + Intergenic
1112524391 13:100130273-100130295 AGCTGCCACTGAGCAGCAGCAGG - Intronic
1112533233 13:100224491-100224513 GGCTCCCACAGTGCAGGGGTGGG + Intronic
1112842640 13:103599900-103599922 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1113372022 13:109733096-109733118 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1113583919 13:111449683-111449705 TCCTGCCACAGGGCAAGTGCAGG + Intergenic
1113594155 13:111519587-111519609 AGCTGCCACAGAACAGCTGTGGG - Intergenic
1114155478 14:20099105-20099127 GGCTCCCACAGTGCAGAGGCGGG - Intergenic
1114372685 14:22107906-22107928 TGCAGCCACAGTACAGGAGCAGG - Intergenic
1114559591 14:23580554-23580576 GGCTCCCACAGTGCAGCTGCGGG - Intergenic
1114603295 14:23973426-23973448 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1114957696 14:27845278-27845300 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1115268691 14:31527527-31527549 GGCTCCCACAGTGCAGTGGCGGG + Intronic
1115421410 14:33199181-33199203 GGTTCCCACAGTGCAGATGCGGG + Intronic
1116297965 14:43136370-43136392 GGCTCCCACAGTGCAGCTGCGGG + Intergenic
1116325747 14:43532947-43532969 AGCTCCCACAGTGCAGCGGTGGG - Intergenic
1116653713 14:47626475-47626497 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1116900902 14:50361874-50361896 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1117082533 14:52166665-52166687 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1117297512 14:54393380-54393402 AGCTCCCACAGTGCAGCGGTGGG - Intergenic
1117297784 14:54394793-54394815 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1117449757 14:55839427-55839449 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1117727398 14:58687694-58687716 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1119303741 14:73590875-73590897 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1120044007 14:79786047-79786069 AGTGGCCACAGTGCTGGAGCTGG - Intronic
1120123509 14:80712527-80712549 AGCTGCCAGAGCCCATGTGCAGG - Intronic
1120215804 14:81679614-81679636 GGCTTCCACAGTGCAGCGGCGGG + Intergenic
1120229828 14:81829890-81829912 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1120332761 14:83114889-83114911 AGAAGCCACAATGCAGATGCAGG - Intergenic
1120632373 14:86905872-86905894 GGCTCCCACAGTGCAGCGGCGGG + Exonic
1120756442 14:88248898-88248920 GTCTGCCACATTGCAAGTGCTGG - Intronic
1121252033 14:92506441-92506463 AGCTGACACAGTGCAGCCACTGG + Intergenic
1122016656 14:98802339-98802361 AGAAGCCCCAGTGCAGGGGCAGG + Intergenic
1122203213 14:100135120-100135142 AGGTGCCAGCCTGCAGGTGCTGG - Intronic
1122894883 14:104751927-104751949 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1123192683 14:106586259-106586281 GGCAGCCCCAGGGCAGGTGCAGG - Intergenic
1202853477 14_GL000225v1_random:36264-36286 ACCTGCCACAGTGCACAGGCCGG + Intergenic
1124036311 15:26056831-26056853 GGCTCCCACATTGCAGCTGCGGG - Intergenic
1124110655 15:26782067-26782089 GGCTCCCACAGTGCAGCTGCGGG + Intronic
1124119909 15:26880254-26880276 AGCTGGCACACTGAAGGGGCAGG + Intronic
1124131038 15:26985906-26985928 AAATGCCACAGTGTAGGTGAAGG + Intronic
1124155229 15:27219483-27219505 AGCTGCCCCATCACAGGTGCAGG - Intronic
1124343300 15:28903756-28903778 ACCTGGCACAGGGGAGGTGCTGG + Intronic
1124387903 15:29225188-29225210 GGCTCCCACAGTGCAGCAGCGGG + Intronic
1125274545 15:37977301-37977323 AGCTGCCAGAGTTCTTGTGCTGG + Intergenic
1125452445 15:39823551-39823573 AGCTGCAGCAGTGGAGGTGAGGG - Intronic
1125565816 15:40677369-40677391 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1126098260 15:45104359-45104381 TGCTGCCCGAGTGCAGGTGCTGG - Exonic
1126105965 15:45147417-45147439 TTCTGCCCAAGTGCAGGTGCTGG + Exonic
1126639609 15:50811887-50811909 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1126997522 15:54462374-54462396 GGCTCCCACAGTGCAGCTGTGGG - Intronic
1127984699 15:64060770-64060792 GGCTCCCACAGTGCAGCAGCGGG - Intronic
1128141123 15:65301514-65301536 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1128451529 15:67808539-67808561 GGCGGCCCCAGGGCAGGTGCGGG - Intergenic
1128569899 15:68726401-68726423 AGGTACCACAGTGTAAGTGCTGG + Exonic
1129724453 15:77894414-77894436 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1129997090 15:80016441-80016463 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1130104747 15:80920957-80920979 TCCTGCCACATGGCAGGTGCAGG - Intronic
1130920127 15:88336759-88336781 GGCTGCCACTGTGCAAGTCCAGG - Intergenic
1131212635 15:90510878-90510900 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1131472884 15:92711459-92711481 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1131645594 15:94338719-94338741 GGCTGCTTTAGTGCAGGTGCGGG + Intronic
1131874469 15:96790087-96790109 TGGTGCCACAGTGAAGGTGTTGG + Intergenic
1131892249 15:96984601-96984623 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1131912524 15:97224166-97224188 GGCTCCCACAGTGCAGCTGGGGG - Intergenic
1132044153 15:98549673-98549695 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1132098926 15:99008677-99008699 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1132155890 15:99495050-99495072 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1132959606 16:2614497-2614519 AGCAGGCACAGTCCAGGTGATGG - Intergenic
1132972667 16:2696472-2696494 AGCAGGCACAGTCCAGGTGATGG - Intronic
1133814327 16:9184603-9184625 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1134095259 16:11414637-11414659 GGCTGCCACAGCGTGGGTGCTGG + Intronic
1134678197 16:16105068-16105090 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1135299453 16:21313222-21313244 GGCTACCACAGTGCAGCGGCGGG + Intergenic
1135604147 16:23808724-23808746 AAGTTCCACGGTGCAGGTGCAGG - Intergenic
1135604872 16:23814944-23814966 ACCTCCAACAGTGCAGTTGCTGG + Intergenic
1136356581 16:29748277-29748299 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1136371628 16:29840369-29840391 ATCTGCCAAAGTGGAGGTGGTGG + Exonic
1137442449 16:48508621-48508643 GGCTCCCACAGTGCAGAGGCGGG - Intergenic
1137636431 16:49991020-49991042 ACCTGCCCCAGAGCAAGTGCTGG + Intergenic
1138168775 16:54829737-54829759 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
1138688710 16:58748768-58748790 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1139018958 16:62724790-62724812 GGCTACCACAGTGCAGCGGCGGG - Intergenic
1139051423 16:63129553-63129575 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
1139147675 16:64343814-64343836 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1139420341 16:66845691-66845713 AGGTGGCTCAGAGCAGGTGCTGG - Intronic
1139748386 16:69092941-69092963 AGCTGCCAAAGTGCAGGAGCAGG - Intergenic
1140806578 16:78537696-78537718 AGCTGCCACAGTTCATGTAGGGG + Intronic
1140989488 16:80194951-80194973 AGCAGCCACAGGGCAGGAGAAGG - Intergenic
1141169302 16:81681033-81681055 AGCTGCCAGGGTGCAGGTGGGGG + Intronic
1141837656 16:86553354-86553376 GGCTCCCACAGTGCAGCTGCGGG - Intronic
1142964706 17:3573352-3573374 ATCTGCCCCTGAGCAGGTGCTGG + Intronic
1143135322 17:4709482-4709504 AACTCCCACAGTGCAGTGGCGGG + Intergenic
1143283299 17:5771163-5771185 AACTCCCACAGTGCAGCAGCGGG - Intergenic
1143460563 17:7100969-7100991 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1143500737 17:7337054-7337076 AACCGCCCCAGAGCAGGTGCTGG - Intronic
1143703697 17:8681768-8681790 CGCTGCCAAAGTTCAGATGCTGG + Intergenic
1144644865 17:16965462-16965484 AGCAGGCACACAGCAGGTGCTGG + Intronic
1145050366 17:19654757-19654779 GGCTCCCACAGTGCAGCTGTGGG + Intronic
1145877651 17:28331764-28331786 CCCTGCCACAGTGGAGCTGCTGG - Intronic
1146259817 17:31414024-31414046 AGCTGACACAGAGCAGGCTCGGG - Intronic
1147265932 17:39234685-39234707 GCCTCCCAAAGTGCAGGTGCTGG - Intergenic
1147635770 17:41962949-41962971 AGCCACCACAGAGCAGGTGCTGG - Intronic
1148991195 17:51668692-51668714 GGCTCCCACAGTGCAGCAGCGGG - Intronic
1149099318 17:52884400-52884422 CGCTCCCACAGTGCAGCGGCGGG + Intronic
1149753917 17:59172443-59172465 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1149916323 17:60613533-60613555 GGCTCCCACAGTGCAGTGGCGGG - Intronic
1150302066 17:64055264-64055286 AACTGGCACAGAGCTGGTGCAGG - Intronic
1150644482 17:66969434-66969456 AGCTGGCACAAAACAGGTGCGGG - Intronic
1150788200 17:68179767-68179789 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1151438567 17:74113750-74113772 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1151840711 17:76615351-76615373 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1151983244 17:77526507-77526529 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1152619113 17:81352483-81352505 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1152620929 17:81364511-81364533 GGCTGCCCCCGTGCAGGTCCAGG - Intergenic
1152785301 17:82244889-82244911 AGATACCACAGTGACGGTGCTGG + Intronic
1152944770 17:83192809-83192831 AGCTGGCACAGGGGAGGGGCTGG - Intergenic
1153822934 18:8847794-8847816 AGGGGCCACTGTGCAGGGGCTGG - Intergenic
1153868634 18:9296768-9296790 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1154128820 18:11717345-11717367 GGCTCCCACAGTGCAGTGGCGGG + Intronic
1154217897 18:12428984-12429006 AGCGGCCTGAGGGCAGGTGCAGG + Intronic
1154231209 18:12557585-12557607 GGCTCCCACAGTGCAGTGGCAGG + Intronic
1154255379 18:12777293-12777315 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1154325995 18:13390771-13390793 AACTGCCACCCTGCAGGTGCTGG - Intronic
1154485623 18:14869658-14869680 AGCTGCTACATTGCAGGTATAGG + Intergenic
1155003254 18:21706434-21706456 GGCTCCCACAGTGCAGCAGCGGG - Intronic
1156079449 18:33316147-33316169 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1156150284 18:34233876-34233898 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1156243101 18:35272066-35272088 GGCTTCCACAGTGCAGCGGCTGG + Intronic
1156324721 18:36064167-36064189 GGCTCCCACAGTGCAGCAGCGGG - Intronic
1156657767 18:39309012-39309034 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
1158282362 18:55841136-55841158 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1158964524 18:62611360-62611382 AGCAGCCTCAGAGCAGGCGCTGG - Intergenic
1159038414 18:63299419-63299441 AGGTGCCCAAGTGAAGGTGCTGG - Intronic
1159260551 18:66006396-66006418 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1159322158 18:66866620-66866642 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1159656268 18:71032147-71032169 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1160198488 18:76777164-76777186 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1160200123 18:76788974-76788996 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1160808563 19:1003141-1003163 GGCTGGCCCAGTGCAGCTGCAGG - Exonic
1161586898 19:5110611-5110633 CCCTGCCGCAGTGCACGTGCCGG + Exonic
1161622864 19:5308502-5308524 AGCAGCCACAGTGCAAGGCCTGG + Intronic
1162128747 19:8512842-8512864 GTCTGCCACAGTGCAGGGGCTGG + Intronic
1162562481 19:11425760-11425782 GGCAGCCTCAGGGCAGGTGCAGG + Intronic
1163328132 19:16618420-16618442 CGCTGTCCGAGTGCAGGTGCTGG - Intronic
1163636758 19:18440613-18440635 AGCTGGCACAGGGCAGCTGGAGG + Intergenic
1164581909 19:29439937-29439959 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1165036325 19:33036558-33036580 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1165415595 19:35691501-35691523 GGCTTCCACAGTGCAGCAGCGGG + Intergenic
1165857355 19:38887681-38887703 AGGTGCCAAACTGCAGGTACAGG + Intronic
1166109165 19:40612164-40612186 ATCTGCCACGGTGCAGGTGGTGG - Exonic
1167516096 19:49924037-49924059 CGATGGCACGGTGCAGGTGCAGG + Intronic
1167596496 19:50431085-50431107 AGCGGCCTCAGTGGAGGGGCAGG - Exonic
1168100154 19:54137366-54137388 AGCTACGACAGTCCAGGGGCGGG - Intergenic
1168339411 19:55614830-55614852 AGATGCCGCAGGGCAGGCGCAGG - Exonic
924967319 2:90911-90933 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
924977535 2:191784-191806 GGCTTCCACAGTGCAGCAGCGGG + Intergenic
925129964 2:1487858-1487880 ACCAGCCAAACTGCAGGTGCAGG + Exonic
925793562 2:7518711-7518733 AACAGCCTCAGGGCAGGTGCAGG + Intergenic
926406072 2:12554322-12554344 ATCTGCCGCAGTGCAGCAGCTGG - Intergenic
926437725 2:12854511-12854533 GGCTCCCACAGTGCAGAGGCAGG + Intergenic
926795844 2:16618193-16618215 AACTGCCTCAGTGCAGGAGCAGG + Intronic
927030896 2:19119497-19119519 GGCTGCCACATTTCAGGAGCTGG - Intergenic
927291339 2:21407948-21407970 AACTGCCCCAGTTCTGGTGCTGG + Intergenic
927357019 2:22186262-22186284 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
927513863 2:23660648-23660670 ACCTGCCACAGGGGAGGGGCTGG - Intronic
927777742 2:25915420-25915442 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
928509352 2:31987619-31987641 ATCTGGCACAGGGCAGGAGCTGG - Intronic
928688498 2:33775268-33775290 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
928723173 2:34142948-34142970 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
928880520 2:36092160-36092182 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
928965206 2:36968805-36968827 AGGCTCCACAGTGCAGGGGCAGG - Intronic
929011116 2:37446063-37446085 AGCTGGCAGAGTGCAGGGGCTGG + Intergenic
929109810 2:38397230-38397252 GGCTTCCACAGTGCAGCGGCGGG - Intergenic
929138077 2:38643502-38643524 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
929522369 2:42665644-42665666 ACCTGCCAAAGTGAAGGTACTGG + Intronic
930338825 2:50084648-50084670 GGCTCCCACAGTGCAGTGGCAGG + Intronic
930585229 2:53259939-53259961 GGCCGCCACAGTGCAGCGGCGGG + Intergenic
931106910 2:59066846-59066868 GGCTCCCACAGTGCAGGGGCGGG - Intergenic
932178219 2:69622002-69622024 GGCTCCCACAGTGCAGCGGCGGG - Intronic
932521714 2:72421747-72421769 GGCTCCCACAGTGCAGCGGCGGG - Intronic
933442138 2:82326647-82326669 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
933487318 2:82938886-82938908 AGCTCCCTCAGTGCAGCGGCGGG + Intergenic
933506268 2:83180962-83180984 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
933511528 2:83246367-83246389 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
933531578 2:83518091-83518113 GGCTTCCACAGTGCAGCGGCGGG - Intergenic
933703459 2:85272862-85272884 TGCAGCCACAGGGCAGGAGCGGG + Intronic
933712208 2:85334792-85334814 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
934085071 2:88503085-88503107 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
935400789 2:102657889-102657911 AGCTGCCAAAGAGCAGGTTCTGG - Exonic
935678946 2:105619607-105619629 GGCTGCCACAGAGAAGGTGCAGG + Intergenic
935755109 2:106270678-106270700 AGCTGTGGCAGTGGAGGTGCGGG - Intergenic
935790253 2:106584338-106584360 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
935866379 2:107392199-107392221 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
935872879 2:107469783-107469805 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
936076396 2:109404446-109404468 AGCAGCCACTCTGCAGGGGCAGG + Intronic
936581595 2:113704846-113704868 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
936857759 2:116980635-116980657 AGCTTCACCAGAGCAGGTGCTGG + Intergenic
937181072 2:119996903-119996925 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
937789485 2:125943366-125943388 GGCTCCCACAGTGCAGAGGCAGG + Intergenic
938369889 2:130762387-130762409 GGCTGCCACAGGGCAGCTGGTGG + Exonic
938399452 2:130976725-130976747 AGCTGGCAGATGGCAGGTGCTGG + Intronic
938611148 2:132948793-132948815 ACCTGCCAAAGTGGAGGTGTGGG - Intronic
938726096 2:134109790-134109812 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
938728717 2:134129861-134129883 GGCTCCCACAGTGCAGCGGCGGG - Intronic
938931267 2:136088464-136088486 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
939003074 2:136758380-136758402 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
939028148 2:137038892-137038914 AGCAGCCACAGTTCAAATGCAGG + Intronic
939085616 2:137715716-137715738 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
939465062 2:142545980-142546002 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
939509644 2:143089876-143089898 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
939738847 2:145881352-145881374 GGCTCCCACAGTGCAGGGGCGGG + Intergenic
939868995 2:147506840-147506862 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
939898843 2:147826780-147826802 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
940112706 2:150171468-150171490 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
941476655 2:165957509-165957531 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
941695920 2:168550797-168550819 AGCTACCCCAGTGCATGTGGTGG - Intronic
941707112 2:168670934-168670956 GCCTGGCACAGAGCAGGTGCTGG + Intronic
941878666 2:170460065-170460087 GGCTCCCACAGTGCAGTGGCGGG + Intronic
942618971 2:177827046-177827068 AGCAGCCACTGTGGGGGTGCGGG + Intronic
942619964 2:177835592-177835614 GGCTCCCACAGTGCAGCAGCAGG - Intronic
943024166 2:182608379-182608401 GGCTCCCACGGTGCAGCTGCGGG - Intergenic
943494816 2:188606835-188606857 AGCTCCCACAGTGCAGCGGTGGG + Intergenic
943520683 2:188944873-188944895 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
943680415 2:190761405-190761427 AGCTCCCACAGTGCAGCGGTGGG + Intergenic
943789989 2:191921576-191921598 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
943906177 2:193502850-193502872 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
944058546 2:195547753-195547775 AGCTCCCACAGTGCAGCAGCGGG + Intergenic
944821976 2:203440802-203440824 AGGTGCCACAGTCTTGGTGCTGG + Exonic
945401336 2:209387298-209387320 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
945744253 2:213701476-213701498 GGCTCCCACAGTGCAGCAGCGGG - Intronic
945907952 2:215615327-215615349 GGCTCCCACAGTGCAGCCGCGGG + Intergenic
946053934 2:216885168-216885190 GGCTCCCACAGTGCAGCCGCAGG - Intergenic
946152826 2:217787697-217787719 GGCTCCCACAGTGCAGGGGCAGG + Intergenic
946376439 2:219312739-219312761 GGCTGCCACAGTGCAGCGGCGGG - Intergenic
947138250 2:226996211-226996233 AGCTGCCACTGGGAAGGGGCTGG - Exonic
947171858 2:227320546-227320568 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
947938084 2:234024723-234024745 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
947961984 2:234247595-234247617 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
948284259 2:236771816-236771838 AGCTGCCACGGAGAAAGTGCTGG + Intergenic
948463115 2:238139603-238139625 GGCAGCCACGGTGCAGGTACAGG - Intronic
948839666 2:240642723-240642745 AGCAGCCACAGTGCAGCAGCAGG - Intergenic
1170412736 20:16108226-16108248 AGCTCCCACAGTCCATGTGGTGG - Intergenic
1170649441 20:18226684-18226706 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1170930823 20:20768358-20768380 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
1171782383 20:29430797-29430819 AGCGGCCACAGCGAAGGCGCTGG - Intergenic
1171973499 20:31579002-31579024 GGCTTCCACAGTGCAGCGGCGGG + Intergenic
1172481446 20:35274209-35274231 CACTGCCCCAGAGCAGGTGCCGG + Intronic
1172878719 20:38182950-38182972 ATCACCCAGAGTGCAGGTGCAGG - Intergenic
1173555316 20:43961599-43961621 ACCCGCCACAGTGCAGCTGGAGG - Intronic
1173560456 20:44001685-44001707 TGCTGGCACAGAGCAGGTGCTGG - Intronic
1173778706 20:45735816-45735838 GGCTCCCACAGTGCAGCTGCAGG - Intergenic
1174486886 20:50866740-50866762 TGCTGGGACAGTGCAGATGCTGG + Intronic
1175403678 20:58714200-58714222 AGCAGCCACAGTGCAGACGAGGG + Intronic
1175582819 20:60113554-60113576 AGCAGACACAGTGAAGGTGGGGG + Intergenic
1175912748 20:62412597-62412619 AGCTGGCATGGGGCAGGTGCAGG - Intronic
1176189318 20:63800482-63800504 GGCTCCCACAGTGCAGCAGCGGG - Intronic
1176215234 20:63944797-63944819 GGCGGCCTCAGTGCAGGGGCTGG - Intronic
1176663166 21:9659954-9659976 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1176795711 21:13369811-13369833 AGCTGCTACATTGCAGGTATAGG - Intergenic
1176872309 21:14093411-14093433 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1178074116 21:29000095-29000117 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1178112826 21:29386115-29386137 TGCTGACATAGTGCAGGTGAAGG - Intronic
1178562410 21:33651163-33651185 AGCTGGTACAGAGCAAGTGCTGG + Intronic
1179418540 21:41217543-41217565 AGCTGCCACAGGGAAGGCACAGG - Intronic
1179541406 21:42085436-42085458 AGCTGCCACAAGGAGGGTGCAGG - Intronic
1180073262 21:45449254-45449276 AGCTGCCGCCGGCCAGGTGCGGG + Intronic
1181133336 22:20747518-20747540 AGGAGCCACAGTGCAGGGGAAGG - Intronic
1181450612 22:23017460-23017482 GGCTCCCACAGTGCAGAGGCGGG + Intergenic
1181468310 22:23122635-23122657 AGCTCCCTCAATGCAGGCGCTGG - Intronic
1181853178 22:25764605-25764627 AGCTGCTACTGTTCAGTTGCTGG - Intronic
1182857940 22:33534685-33534707 GGCTGCCCCAGTGCTGGTTCTGG + Intronic
1183347437 22:37315532-37315554 GGCTTCCACAGAGCAGGTGCAGG + Intergenic
1183462609 22:37961308-37961330 AGCTCCCAAAGTGCTGGAGCTGG + Intronic
1183990294 22:41593445-41593467 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1185221221 22:49630104-49630126 TGCGTCCACAGGGCAGGTGCTGG + Intronic
949281429 3:2352313-2352335 GGCTCCCACAGTGCAGCGGCAGG - Intronic
949769926 3:7568517-7568539 GGCTCCCACAGTGCAGCGGCAGG - Intronic
950099460 3:10348042-10348064 AGCTGCCCGAGTGATGGTGCAGG - Intronic
950207831 3:11093955-11093977 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
950461367 3:13124222-13124244 AGCAGCCAAGGTGCAGGTGAAGG - Intergenic
950600435 3:14029936-14029958 GGCTCCCACAGTGCAGCTGTGGG + Intronic
950601168 3:14037117-14037139 GGCTCCCACAGTGAAGCTGCGGG - Intronic
951024923 3:17818126-17818148 GGCTCCCACAGTGCAGTGGCAGG + Intronic
951024998 3:17818433-17818455 GGCTCCCACAGTGCAGCGGCCGG + Intronic
951184910 3:19702489-19702511 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
951333003 3:21387650-21387672 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
951415380 3:22416871-22416893 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
951734739 3:25851684-25851706 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
952393650 3:32902713-32902735 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
952398172 3:32939602-32939624 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
952593572 3:34988283-34988305 AGCTCCCACAGTGCAGTGGTGGG - Intergenic
953307667 3:41844606-41844628 AGTTCCCACAGTGCAGCAGCAGG + Intronic
953977873 3:47395932-47395954 ACCTGCCAGAGTGTTGGTGCAGG + Intronic
954089389 3:48272364-48272386 GGCTCCCACAGTGCAGCGGCTGG + Intronic
954698385 3:52439491-52439513 CTCTGCCACAGCGGAGGTGCGGG + Intronic
954981483 3:54749931-54749953 AGCAGCCACAGTGGTGGTGGTGG + Intronic
955266520 3:57449787-57449809 GGCTCCCACAGTGCAGCGGCGGG + Intronic
956479563 3:69660586-69660608 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
956563574 3:70611775-70611797 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
956806731 3:72821619-72821641 AGATACAACAGTGCAGGTGAGGG - Intronic
957056221 3:75444855-75444877 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
957386386 3:79502176-79502198 GGCTCCCACAGTGCAGCGGCGGG - Intronic
957446077 3:80314422-80314444 GGCTCCCACAGTGCAGGGGTGGG - Intergenic
957556366 3:81767828-81767850 GGCTCCCACAGTGCAGGGGCGGG + Intergenic
957568859 3:81920010-81920032 GGATGCCACACTGCAGGGGCAGG - Intergenic
957665248 3:83218052-83218074 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
957804971 3:85134302-85134324 GGCTCCCACAGTGCAGCGGCGGG + Intronic
957830089 3:85505117-85505139 GGCTCCCACAGTGCAGCGGCGGG + Intronic
957970326 3:87375238-87375260 GGCTCCCACAGTGCAGAGGCGGG - Intergenic
958810811 3:98858365-98858387 GGCTCCCACAGTGCAGCAGCAGG + Intronic
959422680 3:106148546-106148568 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
960685443 3:120289635-120289657 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
961280059 3:125759019-125759041 GGCTCCCACCGTGCAGCTGCGGG + Intergenic
962177305 3:133167833-133167855 GGCTCCCACAGTGCAGCGGCGGG + Intronic
963397822 3:144756805-144756827 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
963440346 3:145333313-145333335 GGCTCCCACAGTGCAGCGGCTGG - Intergenic
963590038 3:147245995-147246017 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
963651883 3:147989821-147989843 GGCTGCCACAGTGCAGCGCCAGG + Intergenic
963673566 3:148280959-148280981 GGCTCCCACAGTGCAGGGGCGGG + Intergenic
963743066 3:149098290-149098312 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
963760530 3:149283940-149283962 GGCTACCACAGTGCAGCGGCGGG - Intergenic
964198102 3:154087956-154087978 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
964265442 3:154889681-154889703 GGCTTCCACAGTGCAGCGGCGGG + Intergenic
964378469 3:156073080-156073102 GGCTCCCACAGTGCAGTGGCGGG - Intronic
964393844 3:156224366-156224388 GGCTCCCACAGTGCAGCGGCGGG + Intronic
964486239 3:157187465-157187487 AGTTGCCACAGTTCCTGTGCTGG - Intergenic
964717007 3:159732956-159732978 GGCTGCCACAGAGCAGGAGGTGG + Intronic
964982564 3:162703361-162703383 GGCTCCCACAGTGCAGGGGCAGG + Intergenic
965256729 3:166423896-166423918 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
965298063 3:166975753-166975775 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
965586931 3:170327361-170327383 GGCTCCCACAGTGCAGAGGCAGG - Intergenic
966096854 3:176213855-176213877 AGCTCCCACAGTGCAGCGGTGGG + Intergenic
966186215 3:177229001-177229023 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
966246138 3:177809337-177809359 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
966549019 3:181183428-181183450 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
966916804 3:184588868-184588890 AGATGCCACAGTCTAGGTGAAGG + Intronic
967234163 3:187368010-187368032 GGCTCCCACAGTGCAGTGGCTGG + Intergenic
967594978 3:191317442-191317464 GGCTCCCACAGTGCAGCTGCGGG + Intronic
968469624 4:773478-773500 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
968620353 4:1601094-1601116 AGCTGCCACAGTGGAGGTGGGGG + Intergenic
968699046 4:2046222-2046244 TGCTGCCACAGTCCATCTGCAGG + Intergenic
968975797 4:3821510-3821532 AGCTGCCTCAGGGAAGGAGCTGG + Intergenic
968990665 4:3909389-3909411 AGCTCCCTCAGGGCAGGGGCTGG + Intergenic
968999031 4:3965134-3965156 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
969206076 4:5647085-5647107 AGGTGACACAGGTCAGGTGCAGG - Intronic
969718092 4:8877978-8878000 CCCTGGCACAGGGCAGGTGCTGG - Intergenic
969814870 4:9679781-9679803 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
970108256 4:12609553-12609575 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
970272063 4:14358585-14358607 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
970454321 4:16207086-16207108 AGCAGCCACACAGCAGGGGCTGG + Intronic
970574634 4:17414728-17414750 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
971030691 4:22634617-22634639 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
971209187 4:24599557-24599579 GGCTACCACAGTGCAGTGGCGGG + Intergenic
971280592 4:25239673-25239695 GGCTCCCACAGTGCAGTGGCGGG + Intronic
971852031 4:31996308-31996330 GGCTTCCACAGTGCAGCCGCGGG - Intergenic
972405217 4:38739564-38739586 AGCTGACACAGTGCAAAGGCAGG - Intergenic
972890414 4:43551133-43551155 GGCTCCCACAGTCCAGATGCAGG - Intergenic
973041860 4:45477791-45477813 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
973144317 4:46805231-46805253 GGCTCCTACAGTGCAGCTGCAGG + Intronic
973213506 4:47642671-47642693 AACTGCAACACTGGAGGTGCTGG + Intronic
973683721 4:53347864-53347886 ACCAGCAACACTGCAGGTGCAGG + Intronic
973684405 4:53354517-53354539 GGCTCCCACAGTGCAGCGGCAGG + Intronic
973817522 4:54632456-54632478 AGCTCCCACAGTGCAGCAGTGGG - Intergenic
974089942 4:57300610-57300632 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
974186737 4:58456851-58456873 AGATCCCACAGTGCAGCGGCGGG - Intergenic
974792828 4:66712854-66712876 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
974807623 4:66899900-66899922 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
975298756 4:72765818-72765840 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
975994883 4:80302757-80302779 GGCTCCCACAGTGCAGCTGCAGG - Intronic
976846014 4:89489976-89489998 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
977206454 4:94169760-94169782 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
977305351 4:95317582-95317604 GGCTGTCACAGTGCAGGGGCTGG + Intronic
977416622 4:96742497-96742519 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
977507686 4:97923173-97923195 GGCTCCCACAGTGCAGCGGCAGG - Intronic
977885825 4:102250727-102250749 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
978030533 4:103936697-103936719 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
978285466 4:107073017-107073039 GGCTCCCACAGTGCAGCGGCAGG - Intronic
978466192 4:109012393-109012415 GGCTCCCACAGTGCAGTGGCGGG - Intronic
978497846 4:109379039-109379061 AGCTGCACAAGTGCAGGTGTGGG + Intergenic
978514548 4:109557330-109557352 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
978809027 4:112830726-112830748 GGCTCCCACAGTGCAGCTGCGGG - Intronic
979224124 4:118265468-118265490 GGCTTCCACAGTGCAGCGGCAGG - Intergenic
979227080 4:118298783-118298805 TGCCGCCACAGTGAAGATGCAGG - Exonic
979466075 4:121039940-121039962 AGCTGCCAGAGGACAGGAGCGGG - Exonic
979822492 4:125191870-125191892 GGCTCCCACAGTGCAGGGGCGGG - Intergenic
979857565 4:125652170-125652192 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
979984557 4:127297203-127297225 ACCTACCACAGGGCAGGTGCTGG + Intergenic
980739197 4:136928926-136928948 GGCTCCCACAGTGCAGGGGCGGG - Intergenic
980809191 4:137853546-137853568 AGCCCCCACAGTGCAGCGGCAGG - Intergenic
980865862 4:138553088-138553110 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
981169612 4:141605780-141605802 GGCTCCCACGGTGCAGCTGCTGG + Intergenic
981275762 4:142897419-142897441 AGCTCCCACAGTGCAGTGGTGGG - Intergenic
982768875 4:159378017-159378039 GGCTGCCACAGTGCAGCGGCGGG - Intergenic
982985697 4:162203508-162203530 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
983553116 4:169036276-169036298 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
983656674 4:170091150-170091172 GGCTCCCACAGTGCAGCGGCGGG - Intronic
983834299 4:172369911-172369933 GGCTCCCACAGTGCAGCAGCAGG + Intronic
983835454 4:172377980-172378002 GGCTTCCACAGTGCAGCGGCAGG + Intronic
983845530 4:172513789-172513811 ACCTCCAACAGAGCAGGTGCTGG - Intronic
984069231 4:175092031-175092053 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
984580819 4:181508165-181508187 AGCTGGCAGAGTGGAGTTGCAGG + Intergenic
984662192 4:182386480-182386502 GGCTCCCACAGTGCAGTGGCAGG - Intronic
984805407 4:183746880-183746902 GGCTCCCACAGTGCAGGGGCGGG + Intergenic
984812845 4:183810185-183810207 AGCTGCCACCTTGCAGTTGCAGG + Intergenic
985195235 4:187421389-187421411 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
985269242 4:188178898-188178920 GGCTCCCACAGTGCAGCAGCCGG - Intergenic
985324651 4:188754417-188754439 GGCTCCCACAGTGCAGCGGCCGG - Intergenic
985412156 4:189696095-189696117 AGCTCCCACAGTGCAGTGGCGGG + Intergenic
985448434 4:190041319-190041341 AGCGGCCACAGCGAAGGCGCTGG - Intergenic
985797618 5:1974948-1974970 AGCTGTCAGAAGGCAGGTGCTGG - Intergenic
985912985 5:2897521-2897543 AGCAGCCACAGCGCAGGGCCAGG - Intergenic
986075419 5:4331885-4331907 AGCTGCTGCAGTGCAAGGGCAGG + Intergenic
986119391 5:4817560-4817582 ACCCGCCACAGTGGAGGTGCAGG - Intergenic
986121075 5:4837462-4837484 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
986626101 5:9725228-9725250 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
986912595 5:12574915-12574937 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
987283671 5:16436103-16436125 GGCTCCCACAGTGCAGCAGCCGG - Intergenic
987347490 5:16991379-16991401 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
987488884 5:18552137-18552159 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
987696538 5:21341315-21341337 GGCTCCCACGGTGCAGCTGCGGG - Intergenic
987896227 5:23951196-23951218 GGCTGCCACAGTGCAGCGGTGGG - Intergenic
988020577 5:25614996-25615018 GGCTCCCACAGTGCAGCTGTGGG + Intergenic
988035640 5:25823753-25823775 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
988458194 5:31406894-31406916 AACAGCCACAGTGTAGGTTCGGG + Exonic
988755663 5:34245255-34245277 GGCTCCCACGGTGCAGCTGCGGG + Intergenic
988883527 5:35531546-35531568 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
988996512 5:36720149-36720171 AGCTGACACAGTGCCAGAGCTGG - Intergenic
989346736 5:40438579-40438601 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
989523093 5:42423803-42423825 AGCTGCTACAGTGGCGGTGGCGG + Intronic
990243199 5:53836890-53836912 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
990418906 5:55613275-55613297 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
990510803 5:56487717-56487739 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
990512213 5:56499096-56499118 GGCCGCCACAGTGCCGGGGCGGG + Intergenic
990869412 5:60415375-60415397 GGCTCCCACAGTGCAGGGGAGGG - Intronic
990880167 5:60530239-60530261 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
991505371 5:67318782-67318804 AGCTCCCATAGTGCAGCAGCGGG - Intergenic
991743914 5:69711026-69711048 GGCTCCCACGGTGCAGCTGCGGG + Intergenic
991753795 5:69844216-69844238 GGCTCCCACGGTGCAGCTGCGGG - Intergenic
991795486 5:70290758-70290780 GGCTCCCACGGTGCAGCTGCGGG + Intergenic
991803412 5:70400943-70400965 GGCTCCCACGGTGCAGCTGCGGG - Intergenic
991823284 5:70586294-70586316 GGCTCCCACGGTGCAGCTGCGGG + Intergenic
991833111 5:70719329-70719351 GGCTCCCACGGTGCAGCTGCGGG - Intergenic
991887853 5:71290277-71290299 GGCTCCCACGGTGCAGCTGCGGG + Intergenic
992048804 5:72925411-72925433 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
992666609 5:79015637-79015659 AGCTTCCTGAGTACAGGTGCTGG - Intronic
993202260 5:84830720-84830742 GGCTCCCACAGTGCAGCAGCTGG + Intergenic
993770219 5:91917194-91917216 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
994166958 5:96618431-96618453 GGCTCCCACAGTGCAGTGGCAGG - Intronic
994239808 5:97407102-97407124 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
994669690 5:102751987-102752009 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
994701765 5:103142478-103142500 GGCTCCCACAGTGCAGCGGCGGG + Intronic
994768700 5:103954251-103954273 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
994841326 5:104928911-104928933 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
995185374 5:109265972-109265994 GGCTGACACAGAGTAGGTGCTGG + Intergenic
995678849 5:114695375-114695397 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
995975754 5:118033715-118033737 TGCTCCCACAGTGCAGCGGCAGG - Intergenic
996298615 5:121954392-121954414 GGCTCCCACAGTGCAGCGGCCGG + Intergenic
996413647 5:123186145-123186167 AGCTGCCACAGTTCATCTGTGGG + Intronic
996747158 5:126854970-126854992 AGCTCCCACAGTGCAGCGGCAGG + Intergenic
996815510 5:127569375-127569397 GGCTACCACAGTGCAGTGGCGGG - Intergenic
997158255 5:131580475-131580497 GGCTCCCACAGTGCAGCGGCGGG + Intronic
997352155 5:133238911-133238933 GGCTCCCACAGTGCAGCGGCAGG - Intronic
997505229 5:134411815-134411837 GGCTGCCGCAGTGGAGGAGCTGG - Exonic
997716644 5:136047700-136047722 GGAAGCCACAGTGCAGGTCCAGG - Intronic
997857860 5:137389579-137389601 AGCTTCCACAGAGCACTTGCAGG + Intronic
998443871 5:142183870-142183892 AGCTGACACAGTGATGGTGGTGG + Intergenic
998556384 5:143128599-143128621 GGCTTCCACTGTGAAGGTGCTGG + Intronic
998952355 5:147404879-147404901 TGAGGCCACAGTGCAGATGCAGG - Intronic
999348489 5:150845384-150845406 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1000902543 5:166927387-166927409 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1002061981 5:176630510-176630532 AGCTGCCGCAGCGCCGGAGCCGG - Intronic
1002106351 5:176881180-176881202 GGCGGCCACAGTGCGGGAGCTGG - Exonic
1002616381 5:180459094-180459116 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1002681668 5:180969817-180969839 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1002884098 6:1278570-1278592 ACCTGCCACAGTGGAGGAGGAGG + Intergenic
1003081852 6:3027622-3027644 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1003100132 6:3170686-3170708 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1003170911 6:3721205-3721227 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1003177218 6:3761309-3761331 GGCTTCCACAGTGCAGCGGCGGG - Intergenic
1003213688 6:4090062-4090084 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1003224532 6:4191729-4191751 GGCTCCCACGGTGCAGGGGCGGG + Intergenic
1003284910 6:4725746-4725768 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1003306044 6:4930442-4930464 AGCTGCCACAGTGCAGGTGCAGG - Intronic
1003506737 6:6746114-6746136 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1003578353 6:7317174-7317196 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1003589549 6:7425702-7425724 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1003749518 6:9040684-9040706 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1003836276 6:10075118-10075140 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1003897070 6:10617457-10617479 GGCTCCCACAGTGCAGCCGCGGG + Intronic
1004503266 6:16227335-16227357 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1004519257 6:16346802-16346824 AGGTCCCACAGTGCAGCGGCGGG - Intronic
1004607423 6:17206843-17206865 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1004647884 6:17580652-17580674 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1004693355 6:18011625-18011647 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1004883646 6:20032266-20032288 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1004906990 6:20245210-20245232 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1005042323 6:21610301-21610323 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1005059224 6:21761079-21761101 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1005554302 6:26957030-26957052 GGCTCCCACGGTGCAGCTGCGGG + Intergenic
1005561382 6:27045206-27045228 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1005596273 6:27381498-27381520 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1005711960 6:28511759-28511781 GGCTCCCACAGTGCAGCCGCGGG - Intronic
1005713042 6:28520849-28520871 AGCTGCCTCAGTGAAGGCTCAGG + Intronic
1005725117 6:28640182-28640204 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1005749123 6:28866881-28866903 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1006297242 6:33175205-33175227 ACCTGGCACAGGGCAAGTGCTGG + Intronic
1006351157 6:33521926-33521948 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1006417782 6:33914944-33914966 AGCAGCCACTGTGGAGGGGCAGG - Intergenic
1006497956 6:34437446-34437468 GGCTCCCACAGTGCAGCCGCGGG + Intergenic
1007738672 6:43998018-43998040 GGCTTCCACAGTGCAGCGGCGGG - Intergenic
1007746682 6:44047498-44047520 ACCTGGCACAGAGGAGGTGCTGG + Intergenic
1008587539 6:52962878-52962900 TGCTCCCACAGTGCAGCAGCAGG + Intergenic
1008631188 6:53363892-53363914 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1008882351 6:56394117-56394139 TGCAGCCACAATGCAGGAGCTGG + Intergenic
1009470221 6:64023696-64023718 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1009746630 6:67825322-67825344 GGCTCCCACAGTGCAGCCGCAGG - Intergenic
1010224262 6:73474701-73474723 ACCTCCCAAAGTGCTGGTGCTGG + Intronic
1010956256 6:82094032-82094054 AGCTGCCACAGTGTAGGTAGAGG + Intergenic
1011410384 6:87060197-87060219 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1011620147 6:89234886-89234908 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1011974708 6:93282567-93282589 GGCTCCCACAGTGCAGCCGCAGG - Intronic
1012144966 6:95669962-95669984 GGCTCCCACAGTGCAGCGGCCGG - Intergenic
1012189400 6:96261385-96261407 AGCTCCCACAGTGCAGCGGTGGG + Intergenic
1012429201 6:99146705-99146727 AGCTGCCACATGGCAGGAACTGG + Intergenic
1012578276 6:100829632-100829654 GGCTCCCACAGTGCAGCAGCGGG + Intronic
1012850933 6:104446256-104446278 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1013080171 6:106805685-106805707 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1013410847 6:109881607-109881629 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1013694878 6:112689831-112689853 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1013963507 6:115928479-115928501 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1014586250 6:123201878-123201900 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
1014645405 6:123966657-123966679 AGATGCCACAGTTCATTTGCTGG + Intronic
1014738933 6:125125773-125125795 GGCTCCCACAGTGCAGTGGCAGG - Intronic
1015731396 6:136351938-136351960 ATCTGCCCCAGTGGGGGTGCTGG - Intronic
1015890304 6:137963690-137963712 GGCTCCCGCATTGCAGGTGCTGG + Intergenic
1016104793 6:140148560-140148582 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1017066609 6:150534952-150534974 AGCTGCCACAAAGCAGGTGGAGG + Intergenic
1017310107 6:152966369-152966391 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1017383573 6:153857359-153857381 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1018446523 6:163863694-163863716 CTCTGCCACCCTGCAGGTGCAGG + Intergenic
1018551388 6:165002015-165002037 GGCTGCCACAGTGCACTGGCGGG + Intergenic
1019086168 6:169479956-169479978 GGCTCCCACAGTGCAGTGGCTGG - Intronic
1019120009 6:169794737-169794759 GGTGGCCACAGTGCAGGAGCAGG + Intergenic
1019618412 7:1977558-1977580 GGCTCCCACAGTGCAGTGGCAGG + Intronic
1019761123 7:2813666-2813688 AGCTGTCAGAGTGCAGCTGGAGG + Intronic
1020008222 7:4793449-4793471 GGCTCCCACAGTGCAGTGGCGGG - Intronic
1020552335 7:9621886-9621908 GGCTCCCACAGTGCAGGGGCGGG + Intergenic
1020662257 7:10995967-10995989 GGCTCCCACAGTGCAGCTGCAGG + Intronic
1021065817 7:16171013-16171035 GGCTCCCACAGTGCAGCAGCAGG + Intronic
1021280723 7:18714545-18714567 AAATGCCACAGAGCAGGTGCAGG - Intronic
1021520754 7:21536975-21536997 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1021567945 7:22032764-22032786 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1021677579 7:23097070-23097092 AGAGGCCACAGAGCAGGAGCAGG - Intergenic
1021677588 7:23097101-23097123 CTCTGCCCCAGAGCAGGTGCTGG - Intergenic
1021769063 7:23980375-23980397 AGCAGGCACAGTGCTGGTGTAGG + Intergenic
1021858754 7:24884531-24884553 GGGTGGCACAGTGCAGGGGCAGG - Intronic
1023313660 7:38913306-38913328 CTCTGCCACAGCGCAAGTGCTGG - Intronic
1023750629 7:43368776-43368798 AGCTGCCATAGTGTAGGGGTGGG + Intronic
1023923697 7:44649591-44649613 AGCTGGGACAATGCAGGTTCTGG - Intronic
1023964445 7:44955659-44955681 GGCTCCCACAGAGCAGGGGCTGG - Intergenic
1024090545 7:45936316-45936338 TGGTGCCACATTGCAGGTGAAGG + Intergenic
1024465840 7:49711174-49711196 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1024574554 7:50753389-50753411 ACCTGGCACTGTCCAGGTGCCGG - Intronic
1026237054 7:68535541-68535563 AGCCCCCACAGTGCAGCAGCAGG + Intergenic
1027238073 7:76309876-76309898 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1027422962 7:78035075-78035097 GGCGTCCACTGTGCAGGTGCTGG + Intronic
1027674406 7:81141667-81141689 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1027778899 7:82499533-82499555 GGCTCCCACAGTGCAGGGGTGGG - Intergenic
1028070026 7:86440487-86440509 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1028912932 7:96228630-96228652 GGCTCCCACAGTGCAGTGGCAGG - Intronic
1029065401 7:97843305-97843327 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1029257071 7:99276676-99276698 AGCTGACACAGTGCAGGAGGAGG + Intergenic
1029903901 7:104071709-104071731 GGCTCCCACAGTGCAGCCGCGGG - Intergenic
1029988102 7:104940077-104940099 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1030102178 7:105956197-105956219 GGCTCCCACAGTGCAGCGGCAGG + Intronic
1030215781 7:107042758-107042780 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1030367077 7:108657656-108657678 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1031109906 7:117596068-117596090 GGCTCCCACAGTGCAGGGGAGGG - Intronic
1031605582 7:123763611-123763633 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1031902808 7:127429086-127429108 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1032279936 7:130492106-130492128 AGCTGCCGCAGAGGAGGTGCCGG - Exonic
1033065020 7:138146084-138146106 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1033664169 7:143424837-143424859 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1033758655 7:144418338-144418360 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1033759608 7:144424479-144424501 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1033779264 7:144650340-144650362 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1033866704 7:145697809-145697831 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1034100414 7:148445665-148445687 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1034295918 7:149972434-149972456 TGCTCCCACAGTGCTGGTGCAGG + Intergenic
1034407196 7:150912641-150912663 ACATCCCACAGTGCAGGAGCGGG + Intergenic
1034539459 7:151747067-151747089 GGCTGCCACAGAGCAGGTAGTGG + Intronic
1034810134 7:154124468-154124490 TGCTCCCACAGTGCCGGTGCAGG - Intronic
1035289676 7:157829906-157829928 AGCTGCCACTGCAGAGGTGCAGG - Intronic
1035463962 7:159063571-159063593 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1036123886 8:6045458-6045480 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1036135001 8:6152627-6152649 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1036403064 8:8427488-8427510 AGCATCCGCAGTGCAGGTGGGGG + Intergenic
1036952575 8:13154639-13154661 GGCTCCCACAGTGCAGCAGCGGG + Intronic
1037064950 8:14566742-14566764 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1037263904 8:17037258-17037280 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1037417637 8:18668124-18668146 GGCTCCCACAGTGCAGCGGCAGG + Intronic
1037735870 8:21565469-21565491 AGCTGCCACGGTAGAGGGGCAGG + Intergenic
1037836288 8:22216562-22216584 AGCTGCCACTGTCCAGCTGAGGG - Intergenic
1037881565 8:22575813-22575835 AGCTGCCACCGTGGGGTTGCTGG + Intergenic
1039019756 8:33191985-33192007 AGCTGTCACAGAACATGTGCAGG + Intergenic
1039469265 8:37803388-37803410 AGCAGCCAGAGAGCAGGGGCGGG + Intronic
1039587553 8:38719785-38719807 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
1040000811 8:42575135-42575157 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1040014393 8:42689413-42689435 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
1040952830 8:52953733-52953755 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1041068486 8:54104186-54104208 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1041173750 8:55171853-55171875 AGTGGCCATAGTGCAGGTGATGG - Intronic
1041604406 8:59762395-59762417 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1041623497 8:59999784-59999806 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1042169534 8:65978220-65978242 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1042512628 8:69626912-69626934 GGCTCCCACAGTGCAGCAGCGGG + Intronic
1042645479 8:70982020-70982042 ACCTCCACCAGTGCAGGTGCAGG - Intergenic
1042948815 8:74179957-74179979 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1042965549 8:74348075-74348097 ATGTGCCACAGGGCAAGTGCTGG - Intronic
1043435259 8:80231728-80231750 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1043526248 8:81099497-81099519 ACATGCTACAGTGCAGGTTCAGG - Intronic
1043621093 8:82192690-82192712 CGCTCCCACAGTGCAGCGGCGGG + Intergenic
1043670580 8:82880609-82880631 AGCTCCCACAGTGCAGTGGCGGG - Intergenic
1043737635 8:83768094-83768116 ACTTGCCACATTGCAGGTGATGG - Intergenic
1044404830 8:91816284-91816306 GGCTCCCACAGTGCAGCTGCGGG - Intergenic
1044441583 8:92230709-92230731 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
1044459707 8:92429670-92429692 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1044728569 8:95212627-95212649 AGTTTCCAGTGTGCAGGTGCAGG + Intergenic
1045096159 8:98800507-98800529 GGCTCCCACAGTGCAGCGGCAGG - Intronic
1045306084 8:100957548-100957570 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1045879522 8:107021233-107021255 AGCTGCCAGAATGCTTGTGCTGG - Intergenic
1045933680 8:107655525-107655547 AGCTCCCACAGTGCAGTGGCAGG - Intergenic
1046033836 8:108817113-108817135 ATCTCCCACAGAGCAGGTGCTGG - Intergenic
1046149412 8:110203011-110203033 GGCTTCCACAGTGCAGCGGCGGG + Intergenic
1046265454 8:111823722-111823744 GGCTCCCACAGTGCAGTTGGTGG + Intergenic
1046497710 8:115036628-115036650 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1046621156 8:116531008-116531030 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1047100237 8:121667853-121667875 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1047124671 8:121947956-121947978 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
1048112799 8:131486965-131486987 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1048186942 8:132250097-132250119 GGCTCCCACAGTGCAGTGGCAGG + Intronic
1048576086 8:135690836-135690858 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1048677025 8:136794230-136794252 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1048712623 8:137228785-137228807 AGCAGCCACAGTGAAAGTTCTGG + Intergenic
1049157647 8:141076607-141076629 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1049200794 8:141339648-141339670 TGCTGCCCCAGGGCAGGTGGTGG + Intergenic
1049857880 8:144875090-144875112 GGCTTCCACAGTGCAGCGGCAGG - Intergenic
1049874494 8:145007583-145007605 AGCTGCGCAAGGGCAGGTGCGGG + Intergenic
1049944574 9:581215-581237 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1050313951 9:4381983-4382005 AGCTGTCAAAGTCCAGGAGCAGG - Intergenic
1051314251 9:15810843-15810865 GGCTCCCACAGTGCAGCGGCAGG + Intronic
1051425055 9:16924492-16924514 AGATCCCACAGTGGGGGTGCGGG + Intergenic
1051425150 9:16924846-16924868 GGCTCCCACAGTGCAGCAGCGGG + Intergenic
1051892630 9:21959171-21959193 GGCTCCCACAGTGCAGGTGGGGG - Intronic
1052122735 9:24738447-24738469 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1052280625 9:26729374-26729396 AGCTGCCACATGGCAGGTCTGGG + Intergenic
1052313371 9:27092574-27092596 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1052820561 9:33135203-33135225 AGATGCCATAGTCCAGCTGCTGG + Exonic
1053436032 9:38075291-38075313 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1053886548 9:42648534-42648556 AGCTGCTACATTGCAGGTATAGG + Intergenic
1054225567 9:62455984-62456006 AGCTGCTACATTGCAGGTATAGG + Intergenic
1054876477 9:70102419-70102441 TGCTGCCACAGTGATGGTGTGGG + Intronic
1055248658 9:74276371-74276393 GGCTCCCACAGTGCAGCAGCCGG + Intergenic
1055814233 9:80185736-80185758 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1055985563 9:82054772-82054794 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1056216211 9:84408399-84408421 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1056691509 9:88812208-88812230 AGGTCCCACAGTCCAGGTTCTGG - Intergenic
1056799377 9:89681016-89681038 GGCTCCCACAGTGCAGTGGCAGG - Intergenic
1057264371 9:93604204-93604226 GGGTGGCATAGTGCAGGTGCCGG + Intronic
1057291708 9:93810935-93810957 GGCTGCAACATTGAAGGTGCAGG + Intergenic
1057300644 9:93879861-93879883 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1057321247 9:94015023-94015045 AGCTGCCAGAGGGCAGCTGCCGG - Intergenic
1057511071 9:95680251-95680273 GGCTCCCACAGTGCAGGGGTGGG - Intergenic
1057726853 9:97574138-97574160 GGCTCCCACAGTGCAGCGGCGGG - Intronic
1058309452 9:103483633-103483655 GGCTGCCATAGTGCAGCGGCGGG - Intergenic
1058365123 9:104200514-104200536 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
1058396281 9:104557523-104557545 ACCTCCACCAGTGCAGGTGCTGG + Intergenic
1058727457 9:107817713-107817735 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1059791216 9:117643168-117643190 GGCTTCCACAGTGCAGCGGCGGG + Intergenic
1059810553 9:117851946-117851968 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1060172913 9:121476374-121476396 AGCTGGCACTGTGTTGGTGCTGG - Intergenic
1060305440 9:122406595-122406617 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1060354975 9:122897497-122897519 AGCTTCCACAATGCCTGTGCAGG - Exonic
1060382020 9:123184501-123184523 AGCTGCCACATTGTAGCTACAGG - Intronic
1060720023 9:125970435-125970457 AGCTGTCACAGTGAAGGTTCTGG + Intergenic
1060777396 9:126385422-126385444 ACGTGACACAGTGCAGGTGGAGG + Intronic
1061037200 9:128120479-128120501 AGCAGCCAGAGTGCAGGTCGGGG - Intergenic
1061258892 9:129468223-129468245 AGCTCCCTGAGGGCAGGTGCTGG + Intergenic
1061322088 9:129837085-129837107 ATCTGCCACAGCACAGGTGGTGG - Intronic
1061862392 9:133474834-133474856 ACCTGGCACAGAGCAGGTGTGGG + Intronic
1061961137 9:133989952-133989974 ACGTGCCACAGTCCAGGTGACGG + Intronic
1062121126 9:134834635-134834657 GGCAGCCACAGAGTAGGTGCAGG + Intronic
1062138155 9:134940559-134940581 AGCAGGCACACAGCAGGTGCGGG - Intergenic
1062464174 9:136673904-136673926 AACAGTCACAGTGCAGGTGCTGG - Exonic
1203662933 Un_KI270753v1:61811-61833 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1203670438 Un_KI270755v1:6886-6908 AGCTCCCACAGTGCAGCGGCGGG - Intergenic
1186152661 X:6690948-6690970 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1186323318 X:8452932-8452954 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1186602754 X:11056030-11056052 ATCTCCCAAAGTGCAGGTGCAGG - Intergenic
1187005910 X:15232172-15232194 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1187280442 X:17854701-17854723 AGTTGCTACAGTGCAGCTGGAGG + Intronic
1187752145 X:22478569-22478591 ACCTCCCCCAGAGCAGGTGCTGG - Intergenic
1188111947 X:26204722-26204744 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1188359145 X:29231190-29231212 ACCTGGCACAGTGTAGGTGGAGG + Intronic
1189330987 X:40145194-40145216 ACCTGCCAAAGTGTGGGTGCTGG - Intronic
1190056217 X:47182373-47182395 AGCTGACAGAGTGCCGTTGCTGG - Intronic
1191053969 X:56222993-56223015 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1191813674 X:65218933-65218955 ACCTCCAACAGAGCAGGTGCTGG + Intergenic
1193709029 X:84857043-84857065 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1193804109 X:85972798-85972820 GGCTCCCACAGTGCAGCGGCGGG + Intronic
1193827655 X:86245736-86245758 AACTGCCAGAGTTCATGTGCTGG - Intronic
1193951836 X:87809110-87809132 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1194077663 X:89417047-89417069 AGCCCCCACAGTGCAGTGGCAGG - Intergenic
1194384312 X:93235650-93235672 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
1195256255 X:103094033-103094055 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1195460317 X:105116149-105116171 GGCTCCCACAGTGCAGCCGCGGG + Intronic
1195939763 X:110158337-110158359 AGCAGCCTAAGTGGAGGTGCAGG + Intronic
1196197987 X:112855296-112855318 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1196616084 X:117768987-117769009 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1196714545 X:118798875-118798897 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1196762405 X:119211321-119211343 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1196775138 X:119331793-119331815 GGCTCCCACAGTGCAGCGGCAGG - Intergenic
1196860926 X:120026227-120026249 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1197607851 X:128606524-128606546 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1198468062 X:136921350-136921372 GGCTCCCACAGTGCAGCAGCGGG - Intergenic
1198694382 X:139320731-139320753 GGCTCCCACAGTGCAGTGGCGGG - Intergenic
1199028865 X:142972578-142972600 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1199134228 X:144231651-144231673 GGCTCCCACAGTGCAGTGGCGGG + Intergenic
1199285154 X:146046597-146046619 GGCTCCCACAGTGCAGCGGCAGG + Intergenic
1199831844 X:151555592-151555614 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1200070794 X:153528074-153528096 GGGTTCCAGAGTGCAGGTGCTGG - Intronic
1200117831 X:153776916-153776938 TGCTGCCACGGTGCAGCTGAGGG - Exonic
1201232600 Y:11879591-11879613 AGGTGCCACAGAGCAGGGGGTGG + Intergenic
1201261001 Y:12158812-12158834 GGCTCCCACAGTGCAGTGGCAGG + Intergenic
1201423108 Y:13820646-13820668 GGCTCCCACAGTGCAGCGGCGGG + Intergenic
1201424189 Y:13831271-13831293 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
1201468278 Y:14309206-14309228 GGCTCCCACAGTGCAGCGGCGGG - Intergenic
1201469057 Y:14314410-14314432 AGCTCCCACAGTGCAGCAGTGGG - Intergenic
1201469117 Y:14314671-14314693 AGCTGCCTCTTTGCAGGAGCAGG + Intergenic
1201572972 Y:15433763-15433785 GGCTCCCACAGTGCAGCAGCAGG - Intergenic
1201729076 Y:17186036-17186058 AGCTCCCACAGTGCAGCAGTGGG + Intergenic
1201729984 Y:17192694-17192716 GGCTCCCACAGTGCAGCAGCAGG + Intergenic
1201982682 Y:19924157-19924179 GGCTCCCACAGTGCAGCGGCGGG + Intergenic