ID: 1003306045

View in Genome Browser
Species Human (GRCh38)
Location 6:4930448-4930470
Sequence GAAAGCAGCTGCCACAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 2, 3: 60, 4: 346}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003306045_1003306052 3 Left 1003306045 6:4930448-4930470 CCTGCACTGTGGCAGCTGCTTTC 0: 1
1: 1
2: 2
3: 60
4: 346
Right 1003306052 6:4930474-4930496 GGAAAGGCGGGTGGACTGTTAGG 0: 1
1: 0
2: 0
3: 14
4: 141
1003306045_1003306050 -9 Left 1003306045 6:4930448-4930470 CCTGCACTGTGGCAGCTGCTTTC 0: 1
1: 1
2: 2
3: 60
4: 346
Right 1003306050 6:4930462-4930484 GCTGCTTTCGGTGGAAAGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 125
1003306045_1003306051 -6 Left 1003306045 6:4930448-4930470 CCTGCACTGTGGCAGCTGCTTTC 0: 1
1: 1
2: 2
3: 60
4: 346
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306045_1003306049 -10 Left 1003306045 6:4930448-4930470 CCTGCACTGTGGCAGCTGCTTTC 0: 1
1: 1
2: 2
3: 60
4: 346
Right 1003306049 6:4930461-4930483 AGCTGCTTTCGGTGGAAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003306045 Original CRISPR GAAAGCAGCTGCCACAGTGC AGG (reversed) Intronic
900150292 1:1175805-1175827 GAGAGAGGCTGCCACCGTGCAGG + Intronic
900641290 1:3689196-3689218 GAAAGCAGCAGCCTCCTTGCAGG - Intronic
901658280 1:10783029-10783051 GAAAGGAGCCGGCACAATGCAGG + Intronic
901924162 1:12555378-12555400 CAAAGCACCTGGCAGAGTGCTGG + Intergenic
902338071 1:15765184-15765206 CAGAGCTGCAGCCACAGTGCCGG + Exonic
902365218 1:15968773-15968795 GATAGCCCCTGCCACAGGGCAGG + Intronic
903067047 1:20705526-20705548 CAAAGCCGCTGCCTCTGTGCCGG + Intronic
903300616 1:22376003-22376025 GAAAGAAACTTCCACAGTGCTGG - Intergenic
904398828 1:30242203-30242225 AAAGGCACCTGACACAGTGCTGG + Intergenic
904406092 1:30289061-30289083 GAAAGCAGCTTCCACTGTCAAGG - Intergenic
904451741 1:30617332-30617354 AAAAGCGTCTGACACAGTGCTGG + Intergenic
905350922 1:37345881-37345903 TAAAGCAGCTGCCACAGGTCAGG - Intergenic
905396983 1:37673041-37673063 AAAAGCACCTGGCACAGTGCTGG - Intergenic
905849820 1:41265390-41265412 GCAAGCAGCTGCTTCTGTGCCGG + Intergenic
906182097 1:43830518-43830540 CAAAGCAGGTGTCACAGTTCAGG - Intronic
906306095 1:44720241-44720263 GGAGACAGCTGCCACAGTTCTGG + Intronic
907908279 1:58804916-58804938 GAAAGCTGCTGCCACAATCCAGG - Intergenic
908123018 1:61003687-61003709 GAAAGCACCTGCCACACAGCAGG - Intronic
908459819 1:64338578-64338600 GAAATCACCTGCCACACTGGAGG - Intergenic
908525312 1:64982378-64982400 CACAGCAGCAGCCACAGTCCGGG + Intergenic
909192414 1:72571080-72571102 GAAAGCTGTTGCCAAACTGCAGG - Intergenic
909922518 1:81400230-81400252 ACAAGCAGCTGCAGCAGTGCTGG + Intronic
910193336 1:84616716-84616738 GAAAGCAGTTGCCCTAGTCCAGG + Intergenic
910486410 1:87719623-87719645 TAATGCAGCTGCCATAATGCAGG - Intergenic
911174141 1:94802429-94802451 GACAGCAACTCCCACTGTGCAGG - Intergenic
913692173 1:121289540-121289562 GAAAGGGGCTCCCACAGTGCAGG + Intronic
914145382 1:144990574-144990596 GAAAGGGGCTCCCACAGTGCAGG - Intronic
915830602 1:159126255-159126277 TATAGCAGTGGCCACAGTGCAGG - Intronic
916587142 1:166158510-166158532 GAAAGCACCCTGCACAGTGCCGG + Intronic
918477222 1:184937873-184937895 TAAAGCAGCTGACCCACTGCAGG + Intronic
920479497 1:206307888-206307910 GAAAGGGGCTCCCACAGTGCAGG + Intronic
920664844 1:207955677-207955699 GCAAGCAGCAGCCACAGTGATGG - Intergenic
920824420 1:209412115-209412137 GGAAGCAGCTGCCCCAGGGCTGG - Intergenic
920840904 1:209552959-209552981 ACAAGCATCTGCCAAAGTGCTGG + Intergenic
922418962 1:225446846-225446868 GAAAGCCAATGCCACCGTGCAGG + Intergenic
922720412 1:227897242-227897264 CAAACCATCTGCCACACTGCGGG + Intergenic
923489933 1:234475545-234475567 GAATGCAGCTGCCACAGGTTAGG + Intronic
1062884102 10:1003842-1003864 GCAAGCAGCTGCCACAGTGCTGG + Intronic
1063115426 10:3068555-3068577 GAGAGCAGCTTCCACATTGCAGG - Intronic
1063241121 10:4170240-4170262 GAAAGCTGCTGTCTCAGTGTTGG + Intergenic
1063757163 10:9025663-9025685 TACAGAATCTGCCACAGTGCTGG - Intergenic
1065398159 10:25264093-25264115 GAAACCAGTTACCACAATGCTGG - Intronic
1067576579 10:47412504-47412526 GAAAGCCCATGCCACAGTCCTGG + Intergenic
1067711133 10:48652032-48652054 CAGAGCAGCTGCCATAGTTCAGG + Intronic
1067714491 10:48678953-48678975 GAAAGCAGCTTCCTGTGTGCTGG - Intergenic
1067917791 10:50419212-50419234 CAAAGCATTTACCACAGTGCTGG + Intronic
1067944761 10:50682760-50682782 GAAAGCTGCTCCCAGAGTTCTGG - Intergenic
1068383116 10:56285140-56285162 GAAAGCAGGGGCCATAGGGCAGG - Intergenic
1070300240 10:75198281-75198303 GACAGGAGCTTCCACAGTGAGGG - Intergenic
1070880057 10:79847762-79847784 GAAAGCTGCTCCCAGAGTTCTGG - Intronic
1071560684 10:86644926-86644948 AGAAGCAGCTGCCAGGGTGCAGG - Intergenic
1071633169 10:87231852-87231874 GAAAGCTGCTCCCAGAGTTCTGG - Intronic
1071646618 10:87364070-87364092 GAAAGCTGCTCCCAGAGTTCTGG - Intronic
1071803112 10:89086846-89086868 GTAAGCAGCTGGCACCCTGCTGG - Intergenic
1072082019 10:92042183-92042205 GAAAGCAGCATCTAGAGTGCTGG - Intergenic
1072638707 10:97194969-97194991 TAGAGCAGCTCCCTCAGTGCAGG - Intronic
1073024766 10:100479890-100479912 GGCACCAGCTGCCACACTGCTGG - Exonic
1073442555 10:103561132-103561154 GAAGCCAGCTGCCACGGTGTGGG - Intronic
1074114243 10:110443756-110443778 GGAAGCACTGGCCACAGTGCTGG - Intergenic
1075793497 10:125102765-125102787 CAAAGCAGCAGCCACCATGCTGG + Intronic
1075836447 10:125457378-125457400 CACAGCAGATGCCACAGGGCAGG + Intergenic
1076253395 10:129000425-129000447 GAGAGCAGCTGTCCCTGTGCAGG - Intergenic
1077597697 11:3548063-3548085 GAAAGCAGGGGCCACATTTCAGG + Intergenic
1077893980 11:6440198-6440220 GAATGCAGCATCCACAGGGCTGG + Exonic
1079245556 11:18749798-18749820 GACAGGAGCAGCCACAGTTCTGG - Intronic
1079261765 11:18889188-18889210 GAGAAAAGCTGCCACAGTGTTGG + Intergenic
1079358579 11:19751362-19751384 GAAAGCAGCTGCCAGGGGTCTGG + Intronic
1079435242 11:20440843-20440865 GAAAGGACCTGCCACAGAGTGGG - Intronic
1081173790 11:39901167-39901189 GAAAGCAGTTTCAACAGAGCTGG - Intergenic
1081177274 11:39944833-39944855 CAATGCAGCAGCCACAGTCCTGG + Intergenic
1081191325 11:40105468-40105490 GAAAAGAACAGCCACAGTGCGGG - Intergenic
1081597402 11:44468470-44468492 GAATGCAGCTGTCACAGAGCTGG + Intergenic
1083068755 11:59953696-59953718 GAAATCAGCTGCCTCAGAGAAGG + Intergenic
1083311292 11:61785136-61785158 GAAAGCACCTGCAACAGAGGTGG + Intronic
1084253793 11:67923968-67923990 GAAAGCAGGGGCCACATTTCAGG + Intergenic
1084819086 11:71671958-71671980 GAAAGCAGGGGCCACATTTCAGG - Intergenic
1084872681 11:72108751-72108773 GCCAGCAGGTGCCACCGTGCTGG + Exonic
1086034845 11:82403826-82403848 GAAAGGGGCTCACACAGTGCAGG - Intergenic
1086584048 11:88431828-88431850 GACAGCAGGAGCCACAGAGCCGG - Intergenic
1086946184 11:92845907-92845929 GAGAGCAGCTGGCACACTGATGG - Intronic
1087927271 11:103933667-103933689 GAAAGCATCTCACAAAGTGCTGG - Intronic
1088607173 11:111542660-111542682 GCGAACTGCTGCCACAGTGCCGG - Intronic
1089061427 11:115629302-115629324 GCAATCCGATGCCACAGTGCAGG + Intergenic
1090260503 11:125315506-125315528 CAAAACAGCTGCCTCTGTGCTGG - Intronic
1090607600 11:128437488-128437510 GAAGGCAGCTGGAACTGTGCAGG - Intergenic
1092919438 12:13217909-13217931 GAGAGCTGGTGCTACAGTGCGGG + Exonic
1093546513 12:20355069-20355091 GCAAGCAGATGCCAAAGGGCTGG + Intergenic
1093546619 12:20356323-20356345 GCAAGCAGATGCCAAAGGGCTGG + Intergenic
1094670129 12:32562184-32562206 GAACGCAGCTGCTACAATGTAGG - Intronic
1096117755 12:49065389-49065411 GAAAGAAGCTGGCAGAGTCCTGG - Exonic
1096809265 12:54159305-54159327 CCAAGCAGCTGCCACAGAGCGGG + Intergenic
1098572953 12:72009718-72009740 GAAGGCACCTGCCCCAGGGCAGG + Intronic
1099033835 12:77560719-77560741 GAAAGCAGTTTCCACAGAGGGGG - Intergenic
1099775871 12:87129240-87129262 GAAAGCACTTACCACAGTCCTGG + Intergenic
1099955067 12:89345552-89345574 GAAAGCAGCAGCTACAGTTCAGG + Intergenic
1102568348 12:113811914-113811936 AACAGCAGCTGCCCCAGTGCTGG - Intergenic
1104015681 12:124960197-124960219 GTAAGCAGCTGCCGCAGGCCAGG + Intronic
1104051227 12:125195180-125195202 GACAGGGGCTGGCACAGTGCAGG - Intronic
1104312330 12:127664550-127664572 GAAAGCATGTGCCACAGCCCTGG + Intergenic
1104870723 12:131993485-131993507 GACCGCAGCTACCAGAGTGCAGG - Intronic
1105605213 13:21921092-21921114 GGAAGGGGCTCCCACAGTGCAGG + Intergenic
1106595685 13:31133771-31133793 GAAGACACCTGGCACAGTGCCGG + Intergenic
1107349540 13:39499712-39499734 GAAAGGAGCTGGCACAGAGATGG + Intronic
1108500852 13:51068614-51068636 GAACGCAGCTGCCTCATTCCTGG + Intergenic
1109729515 13:66393418-66393440 GAAAGAAGCTGGCACAGTGGTGG + Intronic
1110862074 13:80355471-80355493 GAAAGGGGCTCCCACAGTGCAGG - Intergenic
1111523008 13:89429114-89429136 GAAAGCAACTGCCACATTCTTGG - Intergenic
1112533229 13:100224485-100224507 GAAAGGGGCTCCCACAGTGCAGG + Intronic
1113573049 13:111372301-111372323 GAACGCCGCAGGCACAGTGCTGG - Intergenic
1115465879 14:33713662-33713684 GGAGGCTGCTGCCGCAGTGCAGG - Intronic
1115652713 14:35414631-35414653 CAGAGCAGCTGGCACAGTGTTGG - Intergenic
1117823367 14:59674413-59674435 CAAAGAAGCAGCCACAATGCAGG + Intronic
1117872806 14:60218541-60218563 TAAAGCAGTTCACACAGTGCTGG + Intergenic
1119633087 14:76251064-76251086 CCATGCAGCTGCCCCAGTGCAGG - Intronic
1122238903 14:100348878-100348900 GCAAGCTGCTGCCACTGTGCTGG + Intronic
1122747337 14:103906390-103906412 GAAAGCTGGTGCCATAGTGTTGG - Intergenic
1124044635 15:26137593-26137615 GAAAACCCCTGCCACAGTGTTGG - Intergenic
1127516145 15:59695187-59695209 TAACGCTGCTGCCACTGTGCAGG - Intergenic
1127856559 15:62958398-62958420 GAAAGGAGCTGCCAGAGGTCAGG + Intergenic
1127957856 15:63868722-63868744 TAAAGTAGCTGCCACATTTCAGG + Intergenic
1128813367 15:70587601-70587623 GAAAGGGGCTCCCATAGTGCAGG + Intergenic
1128996835 15:72303590-72303612 GAAAGAAGCTGCCCGAGTTCAGG - Intronic
1129249877 15:74302968-74302990 CAAGGCTGCAGCCACAGTGCAGG - Intronic
1129906616 15:79192079-79192101 CACAGCTGCTGCCACTGTGCAGG + Intergenic
1130089518 15:80808362-80808384 GAATGCAGCTGCCTAAGTGGGGG - Intronic
1130381060 15:83372782-83372804 GACAGCAGATGGCACAGCGCAGG - Intergenic
1131507729 15:93031752-93031774 GAAAGGGGCTCCCACAGTGCAGG - Intergenic
1131771491 15:95742708-95742730 GAGAGCAGATGCTACACTGCTGG - Intergenic
1132145077 15:99424857-99424879 GAAAGCAGCTGCCTCAGTTATGG + Intergenic
1132714982 16:1285757-1285779 GAGAGCAGGTGGCACAGTGTGGG - Intergenic
1132927287 16:2437478-2437500 GAAATCAGCTGGCACAGAGGAGG + Intronic
1133075166 16:3274585-3274607 GAAAGTACATGCCACAGTGTGGG + Intronic
1134245179 16:12534372-12534394 AAAAGAAGCTGCCACAGAGAAGG - Intronic
1134321159 16:13165346-13165368 AAAAGCAGATGACACAGTGGAGG - Intronic
1135760763 16:25136306-25136328 GGGAACAGCTGCCACAGGGCAGG - Intronic
1136479454 16:30532669-30532691 CGAAGCAGCGGCCACACTGCGGG + Exonic
1136588891 16:31205132-31205154 GAGAGCAGCTCCCACAGGGGCGG - Intergenic
1137511205 16:49102235-49102257 GCCATCAGCTGCCAAAGTGCTGG - Intergenic
1138089050 16:54159232-54159254 GAAAGCAGCAGGCATAGTGGAGG - Intergenic
1138520360 16:57567592-57567614 GTATTCCGCTGCCACAGTGCTGG + Intronic
1139137928 16:64227060-64227082 TAAAGCAGCTGCCAAGATGCTGG - Intergenic
1139213594 16:65105632-65105654 GAAAGGAGATGCAACAATGCAGG + Intronic
1140774846 16:78240190-78240212 GAAAGCAGGGGGCACAGTGGTGG + Intronic
1140907912 16:79425719-79425741 GAATGTAGCTAGCACAGTGCTGG - Intergenic
1141151860 16:81569895-81569917 GACAGCACCTACCACAGTACAGG - Intronic
1141469534 16:84229000-84229022 GAAAGCAGCTGCCACTGGGCTGG + Intronic
1142168964 16:88610420-88610442 TAAAGCAGCTTCCTCATTGCAGG + Intronic
1143963909 17:10742368-10742390 GATAGCAGATGCCACAGTCCAGG - Intergenic
1144698810 17:17323352-17323374 GAAAGCCGCTGTCACAGAGGTGG - Intronic
1144873866 17:18386619-18386641 GCAAGCAACTGCACCAGTGCTGG - Intronic
1145771691 17:27497907-27497929 GAAAGAAACTGCCACCGTGACGG - Intronic
1146523962 17:33549979-33550001 GAAAGCATCTGGCAAAATGCTGG - Intronic
1146861961 17:36310862-36310884 GAAACCACCTACCACAGTGCTGG + Intronic
1147092289 17:38114966-38114988 GAAACCACCTACCACAGTGCTGG + Intergenic
1147104920 17:38205533-38205555 GAAACCACCTACCACAGTGCTGG - Intergenic
1148424581 17:47582929-47582951 GAAACCACCTACCACAGTGCTGG + Intronic
1149299102 17:55287843-55287865 CAAAGCAGCTGCCTAGGTGCTGG - Intronic
1151033431 17:70770383-70770405 TATAGCAGCTGCAACAGAGCTGG - Intergenic
1151201278 17:72469773-72469795 GAAAGCAGGTGCCACTGGGAAGG - Intergenic
1151271660 17:73001171-73001193 GAAAGCAGCTACCACTGCTCGGG - Intronic
1151329445 17:73398276-73398298 GAAGGCAGCAGCCTCAGGGCTGG - Intronic
1151724735 17:75877490-75877512 GAAAGCTGCTGCCTCAGCCCAGG + Intronic
1154491563 18:14925905-14925927 AGAAGCAGCTGCCACAGAGGGGG + Intergenic
1155554981 18:27008756-27008778 TTTAGCACCTGCCACAGTGCTGG + Intronic
1155636038 18:27956615-27956637 GAAAGAAGCTGGAACAGTGCTGG - Intronic
1156575808 18:38313742-38313764 GAGAGCTGCTGCCACTGTGCTGG - Intergenic
1156838929 18:41588589-41588611 GTAACCAGATGCCACAGTGTGGG - Intergenic
1157421154 18:47548715-47548737 CAAAGCACCTTGCACAGTGCTGG + Intergenic
1158836237 18:61334041-61334063 GAGAGCAGCTCCCCCAGTCCCGG - Intronic
1159922699 18:74240296-74240318 GAATGCAGCTTCCAAAGGGCCGG + Intergenic
1161621676 19:5301031-5301053 GAAAGCAAAAGCCACATTGCTGG + Intronic
1161675672 19:5647217-5647239 GAAAGGAGATGCCACTGAGCTGG + Intronic
1161755515 19:6130801-6130823 GAAAGCAGGTGCCCCAGTGGAGG + Intronic
1166040286 19:40198238-40198260 GAAAGGACCTGCCACAGAGCGGG + Intronic
1166227213 19:41403706-41403728 GAAAGCACCTGCCGCAGCTCTGG - Intronic
1166253389 19:41586164-41586186 GAGAGCAGCTGCCCTGGTGCTGG - Intronic
1166380527 19:42353057-42353079 GGAAGCTGCAGCCACAGTCCCGG - Exonic
1166867689 19:45850611-45850633 GAAAGGACCTGACACAGCGCAGG + Intronic
1168722541 19:58562122-58562144 GGAAGCGGCGGCCACAGTCCTGG + Exonic
924973459 2:152394-152416 GAAAGTACCCTCCACAGTGCGGG - Intergenic
925831500 2:7900350-7900372 GCAAACAGATGACACAGTGCAGG - Intergenic
926284132 2:11473950-11473972 GGAAGCAGCTGTGACAGTCCAGG - Intergenic
927104231 2:19810174-19810196 GAAAGCAACTGCCACGGTCACGG - Intergenic
927298576 2:21483988-21484010 GAAAGGAGGTGCCACAAGGCAGG + Intergenic
928240277 2:29580071-29580093 GAAAGAAAATGCCACTGTGCTGG - Intronic
928937295 2:36692432-36692454 GTAAACATCTGCCAAAGTGCAGG + Intergenic
928965209 2:36968811-36968833 GAAAGTAGGCTCCACAGTGCAGG - Intronic
929439758 2:41955788-41955810 GAAAGCACTTGGCACAGAGCAGG + Intergenic
931106914 2:59066852-59066874 GAGAGGGGCTCCCACAGTGCAGG - Intergenic
931640003 2:64373696-64373718 GAATGCCTCTGCCATAGTGCAGG + Intergenic
932135795 2:69227459-69227481 TAAAGGAGCGGCCCCAGTGCTGG - Intronic
932705501 2:74021230-74021252 GAAAGCAGCTCCTCCAGAGCTGG - Intronic
933831565 2:86214673-86214695 GAAAGCAGCTGTCATATTTCTGG - Exonic
934949925 2:98569338-98569360 GAAAGCTGGTCCCAGAGTGCCGG + Intronic
936499266 2:113052953-113052975 GAGAACAGCTTCCACAGAGCAGG + Intergenic
937212544 2:120284805-120284827 GAAAGCAGTTGCCAGAGGCCAGG - Intronic
939738843 2:145881346-145881368 GAAAGGGGCTCCCACAGTGCAGG + Intergenic
940354103 2:152719119-152719141 GAAAGCAGCTGCCAGCCTGAGGG - Intronic
940682749 2:156806978-156807000 GAAAGCAGTTCTCACAGTTCTGG + Intergenic
940903358 2:159146991-159147013 GGAGGCAGCAGCCACTGTGCTGG + Intronic
943734445 2:191339140-191339162 GAAGAGAGCTGCCCCAGTGCTGG + Intronic
944470811 2:200051781-200051803 GATGGCAGCTGGCACATTGCAGG + Intergenic
944630883 2:201622819-201622841 GAAAGCTGCTGCCAATGTGGGGG - Exonic
945282369 2:208047987-208048009 GAAATCTGCTGCCAGAGAGCAGG - Intergenic
946433587 2:219638264-219638286 GACAGCAGCTGCCACAGGCTGGG - Intronic
947746588 2:232511204-232511226 CAAAGCAGCTGCTAGGGTGCTGG - Intergenic
948353239 2:237357925-237357947 GAAAGCAGCTGCCACTGGACTGG + Intronic
948829316 2:240590279-240590301 GCAAGCAGCTGGCCCAGTGTCGG + Intronic
948885413 2:240879848-240879870 GAAAGAAGCTGGCACAGTGGAGG - Intronic
1169562766 20:6819712-6819734 GAAAGCCACTGCCACAGTTGTGG + Intergenic
1170163969 20:13343595-13343617 GAAAGCAGGAACCACAGTGGGGG - Intergenic
1170626915 20:18037154-18037176 GAAAGAAACTGCAACAGGGCAGG + Intronic
1171009428 20:21500485-21500507 GTAGGTAGCTGCCACAGTGACGG - Intergenic
1171178263 20:23071418-23071440 GAAAGCAGCTGCAGCAGCCCTGG + Intergenic
1173385241 20:42581456-42581478 GTAAGCAGCTGACACATGGCAGG + Intronic
1173466068 20:43282375-43282397 TAGAGCAGGGGCCACAGTGCTGG + Intergenic
1174202758 20:48818837-48818859 GAAGGCAGCTGCCTCTGGGCTGG - Intronic
1174353720 20:49984866-49984888 GGAAGCACCTGGCAAAGTGCCGG + Intronic
1175481960 20:59318172-59318194 GTAAGCAGCTGTCACCCTGCAGG - Intronic
1175574671 20:60052081-60052103 CAAAGCAGCTGCCCCACAGCTGG - Intergenic
1175942486 20:62543961-62543983 GAAAGCAGATTCCGCGGTGCGGG - Intergenic
1176360686 21:5994839-5994861 ACAAGCAGCTGCCATGGTGCTGG + Intergenic
1176387033 21:6143265-6143287 GAGAGCAGCTTCCACGGGGCTGG - Intergenic
1176983777 21:15412540-15412562 AATAGCTGCTGCCAAAGTGCTGG - Intergenic
1177198415 21:17927579-17927601 GAAAGCAGGAGCCCCAGGGCAGG - Intronic
1179602081 21:42486029-42486051 GAAAGCAGCTGACACACAGGAGG - Intronic
1179736440 21:43394987-43395009 GAGAGCAGCTTCCACGGGGCTGG + Intergenic
1179762832 21:43543711-43543733 ACAAGCAGCTGCCATGGTGCTGG - Intronic
1181475297 22:23164349-23164371 GGAATCAGCTGGCACATTGCAGG - Exonic
1181573735 22:23781353-23781375 GAAGGCAGCGTCCACAGGGCTGG - Exonic
1181949123 22:26541535-26541557 GACAGCAGGTGCTAGAGTGCCGG - Exonic
1183255946 22:36762227-36762249 GGAAGCAGGTTCCTCAGTGCTGG + Intronic
1183333466 22:37233730-37233752 GACAGCAGCTGACACAGGGCAGG + Intronic
1183496094 22:38144934-38144956 GAAATCAGCTCCCACAGACCTGG + Intronic
1183498735 22:38165337-38165359 GAAAGCAGGATCCCCAGTGCAGG + Intronic
1183819722 22:40336172-40336194 GAGTTCTGCTGCCACAGTGCAGG + Intergenic
1183975420 22:41509111-41509133 TACAGGAGCTCCCACAGTGCCGG + Intronic
1184639813 22:45864595-45864617 GGAAGCTGCTGCAACTGTGCAGG - Intergenic
949981309 3:9503379-9503401 GAAAGCTGCCGCCAGAGGGCAGG + Intronic
950443949 3:13025446-13025468 GAAGGCAGCAGGCACAGTGGAGG + Intronic
950494903 3:13327922-13327944 GGAGGCACCTGCCACAGGGCAGG + Intronic
950752750 3:15143823-15143845 GAAAGCAGGGGCCACATTTCAGG - Intergenic
951098771 3:18662530-18662552 TAAAGCACTTGTCACAGTGCTGG + Intergenic
954483710 3:50826208-50826230 GAACGCAGCTGCCACATTTAAGG - Intronic
955974158 3:64464514-64464536 GACAGCAGCTGCCAAACAGCAGG + Intergenic
956197473 3:66667497-66667519 GACAGTAGTTGCCACAGTACTGG + Intergenic
956432546 3:69201792-69201814 GACAGCACCTGGCACAGGGCAGG + Intronic
956721406 3:72121018-72121040 GGAAGCTGGGGCCACAGTGCAGG - Intergenic
956855197 3:73269118-73269140 GAAAGGGGCTCCCACAGTGCCGG - Intergenic
957067866 3:75540441-75540463 GAAAGCAGGGGCCACATTTCAGG + Intergenic
957446081 3:80314428-80314450 GAAAGGGGCTCCCACAGTGCAGG - Intergenic
957556362 3:81767822-81767844 GGAAGGGGCTCCCACAGTGCAGG + Intergenic
957923126 3:86772509-86772531 GAAAGGAGCTGCCCCCCTGCAGG + Intergenic
959120769 3:102229589-102229611 GATAACAGCTGCCTCTGTGCAGG + Intronic
961285290 3:125797539-125797561 GAAAGCAGGGGCCACATTTCAGG - Intergenic
961478026 3:127160739-127160761 GCAAGGAGCCGCCTCAGTGCAGG + Intergenic
961540298 3:127594899-127594921 TGAAGCAGCTGCCCCAGCGCTGG + Intronic
961558465 3:127712613-127712635 CAAAGCACCTGGCACAGTGGCGG - Intronic
962186426 3:133265084-133265106 GAATACAGCTGCCTCACTGCTGG + Intronic
963673562 3:148280953-148280975 GAAAGGGGCTCCCACAGTGCAGG + Intergenic
963791262 3:149584891-149584913 TAAAGCACCTAGCACAGTGCCGG + Intronic
964137047 3:153355747-153355769 GTCATCAGCTACCACAGTGCTGG + Intergenic
964982561 3:162703355-162703377 GAAAGGGGCTCCCACAGTGCAGG + Intergenic
965697793 3:171427553-171427575 TAAAGCACCTGCCACAGAGCAGG + Intronic
965773084 3:172201248-172201270 GAAAGCTGCAGCCCCAGTGGGGG + Intronic
966413109 3:179663551-179663573 GGAAGCTTCTGCCACAGTCCAGG - Intronic
966647448 3:182262421-182262443 GAAAGCACCTGGCCCAGAGCAGG + Intergenic
968126456 3:196163913-196163935 GAAAGCAACTGCCGCAGGCCGGG - Intergenic
969066121 4:4482679-4482701 AGAAGCAGGTGCCAGAGTGCAGG - Intronic
969230613 4:5827794-5827816 GAAAGCAGCTGCCATGGGGATGG + Intronic
969470596 4:7385360-7385382 GAAGCCAGCTGGCTCAGTGCTGG - Intronic
973142035 4:46781604-46781626 GAGAGGGGCTCCCACAGTGCAGG - Intronic
973816274 4:54622367-54622389 GAAAGCAGCAGCCAAAGTCCTGG - Intergenic
974070070 4:57115228-57115250 GAATGCAGTTTCCACAATGCAGG + Intergenic
975828458 4:78343871-78343893 TAAAGCAGCTTCTACTGTGCGGG + Intronic
976565479 4:86547245-86547267 GAAAGGGGATCCCACAGTGCAGG - Intronic
977347842 4:95840195-95840217 GAAATCAGCTCGCAGAGTGCTGG + Exonic
977715290 4:100175238-100175260 GAAATGAGCTGCCACAGGGTTGG - Intergenic
978385015 4:108169418-108169440 GAAAGCCGCTGCCGCTGTGATGG + Intergenic
978768429 4:112429195-112429217 GAAGGCAGCTGCCAGCTTGCAGG - Exonic
979290880 4:118977484-118977506 GAAAGGGGCTCCCACAGTGCAGG + Intronic
979822496 4:125191876-125191898 GAAAGGGGCTCCCACAGTGCAGG - Intergenic
980244601 4:130223438-130223460 AAAAGCAGCTGCCACAACACTGG + Intergenic
980628536 4:135406543-135406565 GAAAGGGGCTCCTACAGTGCGGG - Intergenic
980902240 4:138915914-138915936 GAATGCAGCTGCTGCAGGGCAGG - Intergenic
983840892 4:172455690-172455712 GAAGGCAGCAGCCACAGTCAGGG + Intronic
984346280 4:178531627-178531649 GGAAGCAGCAGCCACAGTGGGGG + Intergenic
984605317 4:181779146-181779168 GAAAACAGATGCCAAGGTGCTGG - Intergenic
984805403 4:183746874-183746896 GAGAGGGGCTCCCACAGTGCAGG + Intergenic
984878440 4:184389911-184389933 GCAAGCAGCGGCCTCAGGGCTGG + Intronic
985703517 5:1387490-1387512 CAAACCAACTGCCACTGTGCCGG - Intergenic
986155177 5:5167034-5167056 GAAAACAGATGTCAGAGTGCAGG - Intronic
986521802 5:8627314-8627336 AGAAGCAGATGCCACATTGCAGG - Intergenic
989633671 5:43512176-43512198 CAAGGCAGCATCCACAGTGCTGG - Intronic
990082847 5:51938078-51938100 GGAAGCAGCGGTCAGAGTGCAGG + Intergenic
990512209 5:56499090-56499112 GAGAGGGGCCGCCACAGTGCCGG + Intergenic
990869416 5:60415381-60415403 GAAAGGGGCTCCCACAGTGCAGG - Intronic
992260509 5:74965840-74965862 GAAGGTAGTTGCCACAGTGCAGG + Intergenic
994515448 5:100766651-100766673 AACAGCTGCTGCCACAGTGCAGG - Intergenic
995671513 5:114609511-114609533 ACGAGCAGCTGCAACAGTGCTGG + Intergenic
995920334 5:117304587-117304609 GAAAGGGGCTCCCACAGTGCAGG - Intergenic
997431499 5:133844134-133844156 GAAAGCAGCTGGATCAGGGCAGG - Intergenic
998282368 5:140823749-140823771 GACAGCCACAGCCACAGTGCTGG + Exonic
1001193089 5:169648504-169648526 TAAAGCACCTGGCACAGTGCTGG + Intronic
1001743463 5:174072039-174072061 GAAACCAGCCTCCTCAGTGCTGG + Intronic
1003250751 6:4427687-4427709 TAAAGCAGTTACCACGGTGCTGG + Intergenic
1003306045 6:4930448-4930470 GAAAGCAGCTGCCACAGTGCAGG - Intronic
1003316785 6:5020186-5020208 GAAGGCAGCAGCCACAGTCAGGG - Intergenic
1005750899 6:28881587-28881609 TAAAGCAGTTGTCACAGGGCAGG - Intergenic
1006587168 6:35123174-35123196 CAAAGAAGCTTCCACAATGCAGG - Intronic
1006653796 6:35572777-35572799 AAAAGAAGGTGGCACAGTGCTGG - Intergenic
1006911231 6:37564906-37564928 GGAAGCTTCTGCCACAGTCCAGG - Intergenic
1007076073 6:39066930-39066952 CAAAGCACCTGGCACAGTCCTGG + Intronic
1007420176 6:41714597-41714619 GAAAGGCCCTGCCAGAGTGCTGG - Intronic
1007549839 6:42720789-42720811 GAAAGCGGCTGCCTCAAGGCAGG + Intronic
1008182945 6:48355853-48355875 GCTAGCAGGTGCCACAGTGCTGG - Intergenic
1008444966 6:51578062-51578084 GCAAACAGCAGACACAGTGCTGG + Intergenic
1008872493 6:56289107-56289129 CAAAGCTCCTGACACAGTGCAGG + Intronic
1011424799 6:87214626-87214648 AAAACCTGCAGCCACAGTGCAGG - Intronic
1012279582 6:97312908-97312930 GAAAGGAGGTGCTACTGTGCTGG + Intergenic
1015489101 6:133805255-133805277 GAAAGCAGATCCAACAGCGCTGG + Intergenic
1017847878 6:158275201-158275223 AAAAGCAGCTGCAACTGTGCGGG - Intronic
1017998215 6:159553490-159553512 GAAAGGAGCTGCTCCTGTGCAGG - Intergenic
1018362781 6:163088223-163088245 TAAAGCAGATGCCACTGTGAAGG - Intronic
1019155579 6:170036811-170036833 CAAAGCAGCTTCCACATTCCAGG + Intergenic
1020552331 7:9621880-9621902 GAAAAGGGCTCCCACAGTGCAGG + Intergenic
1022606613 7:31821807-31821829 GAAAGCAGCAGCCTCACTGTTGG - Intronic
1022939605 7:35220429-35220451 GAAACCAGCTGGGGCAGTGCTGG - Intronic
1023110965 7:36810205-36810227 GAAAGCAGATGCCACCATGGAGG - Intergenic
1023458771 7:40370344-40370366 GAGAGGAGCAGCTACAGTGCAGG - Intronic
1023644485 7:42295194-42295216 CAGAGCAGCTCCCAGAGTGCAGG - Intergenic
1024258156 7:47554589-47554611 GAAAGGAGCTGCAAATGTGCTGG + Intronic
1024294893 7:47833900-47833922 CAGAGAAGCTGCCCCAGTGCTGG - Intronic
1027778903 7:82499539-82499561 GAAAGGGGCTCCCACAGTGCAGG - Intergenic
1029223299 7:99007253-99007275 GACAGCAGCTGTCTCAGAGCAGG + Intronic
1029507259 7:100969797-100969819 GCAAGGGGCTGCCACAGGGCTGG + Intronic
1030109401 7:106013637-106013659 GAAAGCAGCAGCCTCAGGGAGGG + Intronic
1031109910 7:117596074-117596096 GAAAGGGGCTCCCACAGTGCAGG - Intronic
1032399560 7:131614330-131614352 CAAGGCAGCTGCTACAGTGTGGG - Intergenic
1032561937 7:132901381-132901403 GAAATCAGCCACCTCAGTGCCGG + Intronic
1034347725 7:150397498-150397520 GGAAGCCGCGGCCACAGTGCGGG - Exonic
1034401254 7:150863075-150863097 GAGAGAAGATGCCACACTGCCGG + Intergenic
1034548394 7:151804337-151804359 GCAAGCAGCAGCCACACTTCTGG - Intronic
1034919008 7:155063934-155063956 GAGACCAGCTGCAACAGTGAGGG - Intergenic
1035606415 8:933108-933130 GACAGCAGCTGCCACTGTGCAGG - Intergenic
1035830417 8:2688868-2688890 GAGAGCAGCGGCTAGAGTGCCGG - Intergenic
1036246854 8:7125319-7125341 GAAAGCAGGTGCCACATTTCAGG - Intergenic
1036253957 8:7189093-7189115 GAAAGCAGGGGCCACATTTCAGG + Intergenic
1036363535 8:8098386-8098408 GAAAGCAGGGGCCACATTTCAGG - Intergenic
1036887418 8:12568683-12568705 GAAAGCAGGGGCCACATTTCAGG + Intergenic
1036895011 8:12626784-12626806 GAAAGCAGGGGCCACATTTCAGG + Intergenic
1037477316 8:19270383-19270405 GGAAGCAGGTGGTACAGTGCAGG - Intergenic
1038128420 8:24700667-24700689 GAAAGCACCAGGCACAGAGCAGG - Intergenic
1039292581 8:36112347-36112369 GAAGGCAGCTGCCTCAGTGGAGG + Intergenic
1039345822 8:36704251-36704273 ACAAGAAGATGCCACAGTGCAGG - Intergenic
1040335574 8:46414318-46414340 GAAAGAAGCTGCAACACAGCAGG + Intergenic
1040515555 8:48131169-48131191 GGAAGCAGCTGCCTGAGCGCGGG + Intergenic
1041173751 8:55171859-55171881 GGAAGCAGTGGCCATAGTGCAGG - Intronic
1041731560 8:61068414-61068436 CACAGCAGCTGGCACTGTGCTGG + Intronic
1043726039 8:83611542-83611564 GAGAGGGGCTCCCACAGTGCAGG + Intergenic
1044842942 8:96353409-96353431 GAAAGGAGTTGACACAGTACAGG - Intergenic
1046514685 8:115242901-115242923 TAAAGCAACTAGCACAGTGCTGG + Intergenic
1046632520 8:116635475-116635497 GATTGCAGCAGCCACTGTGCAGG - Intergenic
1047770772 8:128028221-128028243 GGAAGCAGCTGCCAGCGCGCCGG - Intergenic
1048053883 8:130845920-130845942 GAAAGCAGCTTGCTCAGTGCTGG - Intronic
1049004403 8:139845636-139845658 GACAGCTGCTCCCACACTGCGGG - Intronic
1049345054 8:142134284-142134306 AGAAGCTGCTGCCACAGTCCAGG + Intergenic
1049598832 8:143497888-143497910 GGAAGCAGCTGGCACAGCACCGG - Intronic
1051413761 9:16817597-16817619 GAAAGCATCTGGCACACTGAAGG + Intronic
1051892634 9:21959177-21959199 GAAAGGGGCTCCCACAGTGCAGG - Intronic
1053454920 9:38226703-38226725 GGAAGCAGAAGCCAAAGTGCAGG + Intergenic
1053591465 9:39518557-39518579 GAAAGGAGCGGCCACTTTGCAGG + Intergenic
1053849310 9:42273916-42273938 GAAAGGAGCGGCCACTTTGCAGG + Intergenic
1054574842 9:66846732-66846754 GAAAGGAGCGGCCACTTTGCAGG - Intergenic
1055968337 9:81887264-81887286 GAAAGTAACTTACACAGTGCTGG + Intergenic
1056329215 9:85508112-85508134 AAAAGCAGATGCCACAAAGCAGG + Intergenic
1056546026 9:87614755-87614777 GATGGCGGCAGCCACAGTGCCGG - Intronic
1056816517 9:89805727-89805749 GGAAGCAGCTCCCACACTGATGG - Intergenic
1057511075 9:95680257-95680279 GAAAGGGGCTCCCACAGTGCAGG - Intergenic
1058005346 9:99907535-99907557 TAAAGCACCTGGCACAGTCCTGG + Intronic
1059733707 9:117081252-117081274 GAAAACAGATGCCACAGCCCAGG - Intronic
1060187952 9:121575296-121575318 GACAGCAGCAGCCACCGCGCAGG + Intronic
1060588599 9:124802034-124802056 CCAGGCAGCTGCCACAGTGAGGG + Intronic
1060671205 9:125471371-125471393 GGAAGCAGGTGCCACAGCCCAGG + Intronic
1060720022 9:125970429-125970451 GAGGGCAGCTGTCACAGTGAAGG + Intergenic
1060908734 9:127331603-127331625 GATAGCAGCTTCCACAGGGAAGG - Intronic
1061374504 9:130215973-130215995 GGCAGCAGCAGCCACAGTACTGG + Intronic
1061387777 9:130300661-130300683 AACAGCAGCTGCCACACTGGAGG - Intronic
1061767075 9:132888211-132888233 GCAAGCAGCTGCCACACCTCAGG - Intronic
1061918455 9:133769365-133769387 CAAGGCAGCTGCCACAGGCCCGG + Intronic
1062081105 9:134623870-134623892 GGAAGCAGCTGTCAGAGTGGTGG + Intergenic
1062183216 9:135202355-135202377 GAAAACAGAGGCCACAGTGTGGG - Intergenic
1062493889 9:136822462-136822484 GAGGGCAGCTGTCTCAGTGCTGG + Intronic
1186118029 X:6325682-6325704 GAAAGCAGCAGCCACTTTGCAGG - Intergenic
1186400102 X:9250111-9250133 GAAAGGAGCTACCACTGAGCAGG + Intergenic
1186611188 X:11139488-11139510 GAAAGCAGCTCCCTAAGAGCGGG - Exonic
1187036946 X:15550087-15550109 GAAAGCAACTGGTACAGAGCAGG + Intronic
1187398767 X:18940903-18940925 GAAAGCAGCTGTCTCAGTCAGGG - Intronic
1187843443 X:23511998-23512020 GAAAGCTGCTGCCACTCTGTGGG - Intergenic
1188422393 X:30006011-30006033 GGCAGCTGCAGCCACAGTGCAGG + Intergenic
1189308369 X:40004166-40004188 GAAGGCAGCTGCTGCAGGGCTGG + Intergenic
1189475202 X:41347394-41347416 GCAAGCAGCAGCCGCAGTGGCGG + Exonic
1191959382 X:66683467-66683489 GAAAGCACCTAGCACAGTGCTGG + Intergenic
1191988947 X:67010979-67011001 GAACACAGCTGCCACTGTGAGGG + Intergenic
1195072392 X:101292894-101292916 GAAAGCAGCGCCGACATTGCTGG - Exonic
1198594418 X:138220717-138220739 GAAAGATGCTGCCACAGTTTAGG - Intergenic
1199159161 X:144587153-144587175 GCAAGCAGCAGCCACACTGGGGG + Intergenic
1199744198 X:150761614-150761636 GTAAACAGCAGCCACAGGGCTGG - Intronic
1201339427 Y:12917485-12917507 GGAAGCAGCAGCCGCAGTGGTGG + Exonic
1201406130 Y:13652213-13652235 AAAAGCAGCAGCCACAGTCAGGG - Intergenic