ID: 1003306051

View in Genome Browser
Species Human (GRCh38)
Location 6:4930465-4930487
Sequence GCTTTCGGTGGAAAGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003306040_1003306051 6 Left 1003306040 6:4930436-4930458 CCCATCCCTGCACCTGCACTGTG 0: 1
1: 3
2: 5
3: 55
4: 447
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306043_1003306051 1 Left 1003306043 6:4930441-4930463 CCCTGCACCTGCACTGTGGCAGC 0: 1
1: 0
2: 0
3: 38
4: 295
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306045_1003306051 -6 Left 1003306045 6:4930448-4930470 CCTGCACTGTGGCAGCTGCTTTC 0: 1
1: 1
2: 2
3: 60
4: 346
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306044_1003306051 0 Left 1003306044 6:4930442-4930464 CCTGCACCTGCACTGTGGCAGCT 0: 1
1: 0
2: 2
3: 69
4: 916
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306039_1003306051 24 Left 1003306039 6:4930418-4930440 CCAGCTATGTCTGGGTTTCCCAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data
1003306041_1003306051 5 Left 1003306041 6:4930437-4930459 CCATCCCTGCACCTGCACTGTGG 0: 1
1: 0
2: 8
3: 62
4: 496
Right 1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003306051 Original CRISPR GCTTTCGGTGGAAAGGCGGG TGG Intronic
No off target data available for this crispr