ID: 1003308397

View in Genome Browser
Species Human (GRCh38)
Location 6:4948301-4948323
Sequence ACATTTTGGAAGTGGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003308391_1003308397 10 Left 1003308391 6:4948268-4948290 CCACCTTGATGTTCAGACACATT 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1003308397 6:4948301-4948323 ACATTTTGGAAGTGGAGCCCTGG 0: 1
1: 0
2: 2
3: 21
4: 244
1003308392_1003308397 7 Left 1003308392 6:4948271-4948293 CCTTGATGTTCAGACACATTTTG 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1003308397 6:4948301-4948323 ACATTTTGGAAGTGGAGCCCTGG 0: 1
1: 0
2: 2
3: 21
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003308397 Original CRISPR ACATTTTGGAAGTGGAGCCC TGG Intronic
900418879 1:2547060-2547082 ACATATTGGAGGTGGGGCTCTGG + Intergenic
901416198 1:9118501-9118523 ACAAGTTGGAACTGGGGCCCAGG - Intronic
901752719 1:11421278-11421300 ATATTTTGAAAGTAGAGGCCAGG - Intergenic
904306534 1:29593787-29593809 CCCTTGTGGCAGTGGAGCCCGGG - Intergenic
904707499 1:32402398-32402420 ACATGTTGGCAGTGGAGACATGG + Intergenic
906275500 1:44512426-44512448 ACAATTTGGATGTGGAGCTCTGG + Intronic
906643088 1:47453152-47453174 ACATTTTGTGAGTGGAGAACAGG + Intergenic
906879868 1:49577981-49578003 ACATTTTGTTAGTGGATCACTGG - Intronic
907675246 1:56511935-56511957 TCAATATGCAAGTGGAGCCCTGG - Intronic
907854598 1:58289968-58289990 ACATTATGGAAAGAGAGCCCTGG + Intronic
907855057 1:58295146-58295168 ACATTTTGGAGGAGGAGACCAGG - Intronic
908052527 1:60248227-60248249 ACATTTTGCTAGTGGATCACTGG - Intergenic
909777178 1:79495971-79495993 AAAATTTGAAAGTGGAGCTCAGG - Intergenic
910098656 1:83552946-83552968 GCACTTTGGTAGTGGAGCCAGGG + Intergenic
910219834 1:84879117-84879139 ACTTTTTAGAAATGGAGCCTGGG - Intronic
912242438 1:107925723-107925745 ACATTTGGGAAGATGAGCTCTGG + Intronic
913064641 1:115239385-115239407 AAATCTTTGAAGAGGAGCCCAGG - Intergenic
913964435 1:143363690-143363712 AAACTCTGGAGGTGGAGCCCAGG + Intergenic
914058804 1:144189296-144189318 AAACTCTGGAGGTGGAGCCCAGG + Intergenic
914120345 1:144777075-144777097 AAACTCTGGAGGTGGAGCCCAGG - Intergenic
915924576 1:160005983-160006005 ATTTTTTGGAAGTGTAGCTCAGG + Intergenic
918790885 1:188826491-188826513 TCATCTTCGAAGTGGAGACCAGG + Intergenic
920000047 1:202790821-202790843 CCATCTTGAAAGTGGAGACCAGG + Intronic
921335833 1:214085005-214085027 AGATTTTGGAAGTGGGGGCAGGG + Intergenic
921399068 1:214700509-214700531 ACAATTTAGAAGTGCAGCCTGGG - Intergenic
921543982 1:216452461-216452483 TTATCTTGGAGGTGGAGCCCTGG + Intergenic
923967138 1:239154549-239154571 ACAACTTGGAAGCAGAGCCCAGG + Intergenic
924577621 1:245294611-245294633 AATTTCTGGAAGTGGAGACCAGG + Intronic
1065177079 10:23088139-23088161 GCATTTAGGAGGTGGAGACCAGG + Intergenic
1065645288 10:27827562-27827584 ACATTTTGGATGTGATGCCTGGG - Intronic
1066954755 10:42153862-42153884 ATGTTTTGCAAGTGGAGTCCAGG + Intergenic
1067478553 10:46581317-46581339 ACAGATTGGAATTGGAACCCAGG + Intronic
1067616184 10:47760484-47760506 ACAGATTGGAATTGGAACCCAGG - Intergenic
1068766623 10:60771627-60771649 ACATTTTTGAGGTTCAGCCCAGG + Intergenic
1069039044 10:63675425-63675447 AAATCTTGGAGATGGAGCCCAGG - Intergenic
1070489139 10:76959364-76959386 ACATTTTGGCTCTGGAGCCAGGG - Intronic
1071704943 10:87987866-87987888 ACATCTTGGAAGCAGAGACCAGG - Intergenic
1071836464 10:89423064-89423086 ACATCTTGGAAGCAGAGACCAGG - Intergenic
1072047006 10:91667065-91667087 ACAATTTGGCAGTGGAGACATGG + Intergenic
1072744439 10:97929943-97929965 ACATTTTAAAAGAGGAGCCCAGG + Intronic
1072995030 10:100236069-100236091 ACAATTTGGAACTAGAGCACTGG - Intronic
1073786913 10:106899656-106899678 ACTTTGTGGAAATGCAGCCCTGG - Intronic
1073961623 10:108937421-108937443 ACACTTTGGGAGTGTGGCCCAGG + Intergenic
1074411281 10:113230664-113230686 GCATCTTGGAGGTGGAGCCCAGG + Intergenic
1076324037 10:129607133-129607155 ACTTCTTGGAAGTGCAGTCCGGG + Intronic
1076540041 10:131207981-131208003 TCATTGTGGAAGTGGAGTTCGGG - Intronic
1077400028 11:2350527-2350549 CAATGTTGGAAGTGGAGCCTTGG + Intergenic
1079274083 11:19017347-19017369 ACATTTCTGAAGTGTAGACCTGG - Intergenic
1079547311 11:21647904-21647926 CCATTTTGGAAATGGAGACAGGG + Intergenic
1081507909 11:43737380-43737402 AAAATCTGGAAGTGGAGCCCTGG + Intronic
1086060845 11:82698501-82698523 ACATCTTGGAAGCAGAGACCAGG + Intergenic
1091759635 12:3078079-3078101 ACATCTTGGAACTGGAGTCTTGG + Intronic
1092390388 12:8072173-8072195 GCATTTTGGGAGTTGAGGCCAGG - Intergenic
1092521851 12:9283923-9283945 ACATTCCGGAAGTGGAGGGCCGG + Intergenic
1092765763 12:11851194-11851216 CCATTTTGGAAGGGGAGGCCAGG - Intronic
1093251031 12:16805105-16805127 AGATGTTGGAGGTGGAGCACTGG + Intergenic
1093465334 12:19442498-19442520 ACATTTAGGAAGTGGAGTTGTGG + Intronic
1094507521 12:31074118-31074140 ACATTCCGGAAGTGGAGGGCCGG + Intronic
1095807321 12:46334118-46334140 AAATTTTGAAAGTGGAGACAAGG + Intergenic
1095990731 12:48032771-48032793 AGGTTTTGGGAGTGGGGCCCAGG + Intergenic
1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG + Intergenic
1097751970 12:63365571-63365593 ATATTTTGGAAGTGGATAACTGG - Intergenic
1100004761 12:89881454-89881476 CCATTTTGGAAGCAGAGACCAGG + Intergenic
1102602669 12:114043939-114043961 TGACTTTGGAAGTGGAGCCTAGG - Intergenic
1104267253 12:127244985-127245007 ACAGTTTGAAAATGGAGCCAAGG + Intergenic
1104301873 12:127571719-127571741 TCCATTTGGAAGAGGAGCCCTGG - Intergenic
1104464630 12:128980286-128980308 AACTTTTGGAAGTGGAGACAGGG + Intronic
1104547305 12:129723895-129723917 ACATCTTGGTAGTGGAGGGCAGG - Intronic
1105822217 13:24089865-24089887 TCATCTTGGAAGTGGAGACTGGG - Intronic
1108719380 13:53115436-53115458 CCATTTTAGAAGTGGATTCCCGG - Intergenic
1108790196 13:53960906-53960928 ACATCTTGGAAGTGAAGAGCAGG + Intergenic
1108972832 13:56399119-56399141 ACATTTTGTGAGTAGAGGCCAGG + Intergenic
1109563052 13:64077266-64077288 ACAGTGTGGAAGGGGACCCCAGG + Intergenic
1109959920 13:69616551-69616573 ACATGATGAAAGTTGAGCCCCGG + Intergenic
1111282705 13:86048409-86048431 GAATTTTGTAAATGGAGCCCAGG - Intergenic
1111591172 13:90349370-90349392 ACAGTGTGGAAGGGGACCCCAGG - Intergenic
1113563292 13:111301247-111301269 ACATTTTAAAAGTGAAGCTCTGG - Intronic
1116054462 14:39846067-39846089 ACATCTTAGAAGTGGTGCCAGGG - Intergenic
1116127312 14:40804338-40804360 AAATTTTTGCAGTGAAGCCCTGG + Intergenic
1117139226 14:52769619-52769641 ACAATTAGGAAGTTGAGCCTTGG - Intronic
1117825902 14:59703270-59703292 CAATGTTGGAGGTGGAGCCCAGG + Intronic
1118698362 14:68408270-68408292 ACATTTTGAAAATGGAGCTGAGG + Intronic
1119183263 14:72618595-72618617 ACATTGTGGAAATGGTGCCAAGG - Intergenic
1120515312 14:85463617-85463639 ACATGTTGGAGGTGGGGCCTAGG + Intergenic
1121901873 14:97700271-97700293 ACAATTTGGAAGTTGCTCCCTGG + Intergenic
1121954664 14:98203056-98203078 CCACCTTGGAAGTGGAGACCAGG - Intergenic
1122413939 14:101539593-101539615 CCATTTGGGACGTGGAGCTCAGG - Intergenic
1124022423 15:25936979-25937001 CCATCTTGGAAGCGGAGACCTGG + Intergenic
1124999329 15:34754557-34754579 CCATTCTGGAAGTGCGGCCCGGG - Exonic
1127552126 15:60050808-60050830 CCATCTTGGAATTGGAGACCAGG + Intronic
1128870276 15:71149871-71149893 ACATCATGGAACTGGAGCTCTGG - Intronic
1130687223 15:86049152-86049174 ACATTTTGGGAGGGAAGCCCAGG - Intergenic
1131596533 15:93803646-93803668 ACATCTGGAAAGCGGAGCCCCGG + Intergenic
1132045242 15:98557945-98557967 ATATTTTGGAGTTGGAGCGCTGG + Intergenic
1132839679 16:1972901-1972923 ACATCTGGGAAGAGAAGCCCAGG + Intronic
1134382568 16:13741381-13741403 ACATTTAGGAAGTCCAGCGCTGG - Intergenic
1137872577 16:51964655-51964677 AAACTTTGGGAGTTGAGCCCAGG - Intergenic
1138955715 16:61968181-61968203 ATTTTTTGGAAGTGGATCACAGG - Intronic
1141215664 16:82020996-82021018 ACATTTGGAGAGTGGAGTCCAGG - Intergenic
1141870727 16:86783777-86783799 CCTTTCTGGAAGTCGAGCCCTGG - Intergenic
1141879496 16:86848343-86848365 ACATTTTGGAAATTAAGACCAGG - Intergenic
1142226865 16:88881792-88881814 GCTTTTTGGAAGGGGAGCCCAGG - Intronic
1142859618 17:2753288-2753310 TAATTTTGGAAATGGAGCCAGGG - Intergenic
1144043867 17:11437358-11437380 ACATTCTCGAAGTGGATCACGGG + Intronic
1144323550 17:14155360-14155382 ACATTACAGAATTGGAGCCCAGG + Intronic
1147426036 17:40346351-40346373 TCATTTTAGAAGTGGGGCCTTGG + Intronic
1149791053 17:59477767-59477789 ACATTTTTGAACTGGAGCCCAGG - Intergenic
1152252270 17:79218360-79218382 CCAGCTTGGAAGTGGAGCCGGGG + Intronic
1153492913 18:5668103-5668125 ACATTTTGGAAGTGCCACTCAGG - Intergenic
1155179615 18:23332683-23332705 ACATTTTGGAAGTGCTACACTGG - Intronic
1157315996 18:46590218-46590240 AAACTCTGCAAGTGGAGCCCAGG + Intronic
1157470371 18:47983666-47983688 AGATTCTGGGAGTGGGGCCCAGG - Intergenic
1157483103 18:48068559-48068581 ACTTTCTGGAAATGGAGCCTGGG + Intronic
1157554852 18:48606692-48606714 ACATTGAGGGAGTGGAGCTCTGG + Intronic
1162086521 19:8252819-8252841 TCATTTTGGAGGTGGAGGGCGGG - Intronic
1164804919 19:31109219-31109241 ACCTTGTGTGAGTGGAGCCCGGG - Intergenic
1165383963 19:35499768-35499790 ACAGTTTGGAAGTGGAGGGCAGG - Intronic
1166314601 19:41982010-41982032 AGATGGTGGACGTGGAGCCCAGG + Exonic
1166608243 19:44164830-44164852 ACATTCCGGAAGTGTAGTCCAGG + Intergenic
1168305145 19:55431169-55431191 ACATGGTTGAAGTGGATCCCTGG + Exonic
1202698207 1_KI270712v1_random:141181-141203 AAACTCTGGAGGTGGAGCCCAGG + Intergenic
925468529 2:4134067-4134089 GCATTTGGGAGGTGGAGACCAGG + Intergenic
925833318 2:7917912-7917934 CCATTTTGGAAATGGATCCTCGG - Intergenic
925836614 2:7952596-7952618 ACATCTGGGAAGTGGTGACCTGG - Intergenic
926234500 2:11028991-11029013 ACATTTTGGGAATGGAGCAGGGG - Intergenic
926616468 2:15001908-15001930 ACAGTGTGGAAGGGGACCCCAGG + Intergenic
927478199 2:23430169-23430191 ACACTCTGGAAGTGAGGCCCAGG - Intronic
927920253 2:26966848-26966870 GCATTTAAGAAGTGGAGGCCAGG + Intergenic
928007204 2:27573648-27573670 ACATCTTGCGAGTGAAGCCCAGG - Intergenic
928448163 2:31351390-31351412 ACATGTTGGAAGCAGAGCTCAGG - Intronic
928880715 2:36093143-36093165 ACAGTGTGGAAGGGGACCCCAGG - Intergenic
929812127 2:45199575-45199597 CCATCTTGGAAGTGGAAACCAGG + Intergenic
931522951 2:63119259-63119281 ACATTGTGGGAGGGGAGGCCAGG + Intergenic
933302561 2:80559008-80559030 ACATTTAGCAGGTGGAGTCCAGG - Intronic
934279460 2:91598964-91598986 AAACTCTGGAGGTGGAGCCCAGG + Intergenic
936810607 2:116396236-116396258 ACATTTTGTATGTGGAGACCAGG + Intergenic
937355527 2:121195989-121196011 ACAGCTTGTAAGTGGAGCCCAGG + Intergenic
937856156 2:126673278-126673300 ACATCTTGGAAGTTGGCCCCCGG + Intronic
937891120 2:126939817-126939839 ACAGTTGGGAAATGGAGCACAGG + Intergenic
938010759 2:127827095-127827117 CCATTTTGGAAATGGAGAACAGG + Intergenic
938728958 2:134131010-134131032 ACACTATGGAAGGGGACCCCAGG - Intronic
940478715 2:154200564-154200586 CCATCTTGAAAGTGGAGACCAGG - Intronic
941456605 2:165717009-165717031 AAATTCTGGAAGTAGAGGCCAGG + Intergenic
943209331 2:184942693-184942715 ACATTTTAAAAATGTAGCCCTGG - Intergenic
946900075 2:224363851-224363873 ACAACTAGTAAGTGGAGCCCTGG - Intergenic
947121019 2:226814918-226814940 ACAGCATGGAAGAGGAGCCCAGG + Intergenic
1172193543 20:33076808-33076830 ACCTTTTGGAAGCTAAGCCCAGG + Intergenic
1172777640 20:37416673-37416695 ACCTTTTGGAAGCGGATCCAAGG + Intergenic
1173239819 20:41284536-41284558 AGATTTAGGAAGTGGAGAACTGG - Intronic
1173429822 20:42977132-42977154 GCATTTTGGATTTGGAACCCAGG - Intronic
1174657235 20:52181752-52181774 AGATTCAGGAGGTGGAGCCCGGG + Intronic
1175988505 20:62776253-62776275 ACAGTGTGGGAGTGGAGGCCTGG - Intergenic
1178599534 21:33984023-33984045 TCATTCTGGAAGTGCAGGCCTGG + Intergenic
1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG + Intergenic
1181991551 22:26840699-26840721 AAATTTTAGAGGTGAAGCCCTGG + Intergenic
1182662652 22:31935970-31935992 ACAATTAGCAAGTGGGGCCCAGG + Intronic
1183629309 22:39023742-39023764 AAATGTGGGAAGTGGAGGCCAGG - Intronic
1184458816 22:44625837-44625859 ACATTTGGGAAGGGGAGTGCAGG + Intergenic
1184470455 22:44692719-44692741 ACAGGTTGGGAGTGCAGCCCGGG + Intronic
1184518172 22:44975782-44975804 GCGAGTTGGAAGTGGAGCCCTGG - Intronic
1184548319 22:45189169-45189191 ACATTTTGCAACTGGCCCCCTGG + Intergenic
949213480 3:1535522-1535544 AAAATGTGGAAGTTGAGCCCAGG + Intergenic
950143747 3:10633286-10633308 ACCTTTTGGAAGCGGAGGCAGGG - Intronic
950621281 3:14207524-14207546 AAACTTTGGAAGTAGAGCCCAGG + Intergenic
950673026 3:14538579-14538601 ACTTTTTGGAAGAAGAGCCTTGG + Intronic
954492104 3:50916044-50916066 CCATTTTGGAAGTGGAACTATGG - Intronic
954843678 3:53535197-53535219 ACAGTTTGGAATTTGAGCCTGGG + Intronic
955319827 3:57966304-57966326 AATCTCTGGAAGTGGAGCCCAGG - Intergenic
955447370 3:59028102-59028124 ACATTTTGCATGTGGAGCAAAGG - Intronic
959154785 3:102653559-102653581 CCATTTTGGAAGTGAAGACCTGG + Intergenic
960234637 3:115267646-115267668 AAATGTTTGAACTGGAGCCCAGG + Intergenic
962375315 3:134854046-134854068 ATATTTTGGCATTGGAGCCTTGG - Intronic
963533667 3:146501734-146501756 CCATCTTGGAAGTAGAGACCAGG - Intergenic
965196384 3:165601764-165601786 ACATTTCAGAAATGGTGCCCAGG - Intergenic
966327467 3:178773066-178773088 ACACTTTGGAAGGGGAAACCTGG + Intronic
968759203 4:2433388-2433410 ACATCTTGTCAGAGGAGCCCAGG - Intronic
969203550 4:5624664-5624686 ACAGTAAGGAAATGGAGCCCTGG + Intronic
970447867 4:16139381-16139403 TCATTTAGGATGAGGAGCCCTGG - Intergenic
970645543 4:18116263-18116285 CCATTTTTGAAGTGGAGTCTTGG + Intergenic
971563702 4:28113627-28113649 ACAGTGTGGAAGGGGACCCCAGG - Intergenic
971815873 4:31488062-31488084 TCATTGTGGAAGTAGAGCACTGG - Intergenic
973334963 4:48946766-48946788 ACATTTATTAAATGGAGCCCAGG - Intergenic
974748648 4:66108141-66108163 ACATTTAGTGAGTGGAGGCCAGG + Intergenic
975470471 4:74760350-74760372 ACATATAGGAAGTAGAGCCTAGG + Intronic
976564291 4:86535811-86535833 ACATTTTGAAATTTCAGCCCTGG - Intronic
977880467 4:102198533-102198555 ACATTTTAGTAGTGGAGACAGGG - Intergenic
979387689 4:120088660-120088682 CCATCTTGGAAGTGAAACCCCGG - Intergenic
981407467 4:144387689-144387711 CCATTTTGGAAGCAGAGACCAGG - Intergenic
981495804 4:145390984-145391006 ACATTTTGAAATTGGAGAGCAGG + Intergenic
981856097 4:149294749-149294771 ACATTTTGGAAGAGGAGAAAAGG - Intergenic
981911845 4:149991093-149991115 CCATCTTGGAAGTAGAGACCAGG - Intergenic
982524345 4:156458547-156458569 TCATCTTAGAAGTGGAGACCAGG + Intergenic
983156817 4:164358123-164358145 ACATTATGCAACTAGAGCCCAGG + Intronic
984771211 4:183437715-183437737 ACATTGATGAACTGGAGCCCTGG + Intergenic
986503037 5:8420555-8420577 ACATTTTGGAAGTGGAGAACAGG + Intergenic
987559247 5:19496908-19496930 TCATCTTGGAAGCAGAGCCCAGG + Intronic
987647570 5:20694167-20694189 CAATCTTGGAAGTGGAGACCAGG + Intergenic
987967099 5:24891530-24891552 ACAATTTGTGAGTGGAGCCCTGG + Intergenic
988055505 5:26089320-26089342 AAATTTGCCAAGTGGAGCCCAGG + Intergenic
988420165 5:30995932-30995954 AAATTTAGGATTTGGAGCCCAGG - Intergenic
994335601 5:98561878-98561900 CCATCTTGGAAGTGGAGACCAGG + Intergenic
994497532 5:100532896-100532918 AATTTTTGGAAGTGGAGACATGG + Intergenic
996064249 5:119064574-119064596 ACAATTTGGAAGTGTGTCCCAGG - Intronic
997086843 5:130810466-130810488 ACATTTTAGAAGGTGAGCCTTGG - Intergenic
997447654 5:133953181-133953203 AGATTCTGGAAATGGAGCCAGGG - Intergenic
998607540 5:143650257-143650279 AAATTTTGGCAGTGTAGCTCTGG + Intergenic
1000588428 5:163128653-163128675 CCTTTCTGGAAGAGGAGCCCAGG - Intergenic
1000955895 5:167543079-167543101 AAACTTTAGAGGTGGAGCCCAGG + Intronic
1001416215 5:171546211-171546233 ACAGTCTGGAAGAGGAGACCAGG + Intergenic
1003308397 6:4948301-4948323 ACATTTTGGAAGTGGAGCCCTGG + Intronic
1007836547 6:44678362-44678384 CCCTTTTGGAAGTGGAGTCATGG - Intergenic
1009587799 6:65628460-65628482 ACACTGTGGAAGGGGACCCCAGG - Intronic
1010526718 6:76908768-76908790 ACATTTTTGATGAGAAGCCCTGG + Intergenic
1012163840 6:95923736-95923758 AGATTTTGGAAACTGAGCCCAGG - Intergenic
1013076705 6:106778162-106778184 AAACTTTGGGAATGGAGCCCAGG + Intergenic
1016089737 6:139962247-139962269 ACATTTTTGAAGTGGAATCAAGG + Intergenic
1020597300 7:10223771-10223793 CCACTTTGGAAGTGGAGACCAGG - Intergenic
1021162552 7:17294189-17294211 AAATTTTTGTAGTGGAGCCAAGG + Intergenic
1021539634 7:21742942-21742964 CCATTTTGGAAGCAGAGACCAGG - Intronic
1023032905 7:36106662-36106684 CCATTTTGGACTTGGGGCCCAGG + Intergenic
1023858075 7:44197855-44197877 AGATTTTGGAAGTGGAGTTTCGG - Intronic
1024087121 7:45902851-45902873 ACAGTTTGGAATTTGTGCCCAGG + Intergenic
1024265421 7:47602583-47602605 CCATTTTGGAAGAGCAGACCAGG + Intergenic
1026211537 7:68310260-68310282 CCATTTTGGAAATGGAGGCTTGG - Intergenic
1029552698 7:101245942-101245964 CCATTTTGGGAGTGCACCCCAGG + Intronic
1031262137 7:119534097-119534119 ACATGGTGAAAGTGGAGCACAGG - Intergenic
1032848500 7:135772326-135772348 ACATTTTGAACAAGGAGCCCTGG + Intergenic
1033148270 7:138890458-138890480 CCATTTAGGAAGTGGAGACAAGG + Intronic
1033426645 7:141250773-141250795 ATAATTTCCAAGTGGAGCCCTGG + Intronic
1035078915 7:156200153-156200175 ACAGCTTGGATGTGGAGACCTGG - Intergenic
1035283113 7:157789518-157789540 ACACTTTTGAAGAGAAGCCCAGG - Intronic
1037087842 8:14875158-14875180 TCATTTTGGAAGTGGAGATGAGG - Intronic
1040557449 8:48493541-48493563 GCATTTTTGGAGTGGAGCCTTGG + Intergenic
1042211873 8:66389395-66389417 CCAACTTGGAAGTGGAGACCAGG - Intergenic
1044928674 8:97231308-97231330 CCATGTTGGAAATGGAGACCAGG + Intergenic
1046268553 8:111862485-111862507 CCATTTTGGAAATGCAGACCAGG - Intergenic
1046565422 8:115893435-115893457 TCATTTTAGATGTGGAGTCCAGG + Intergenic
1047291687 8:123537214-123537236 CCATTTAGGAATTGGAGCACAGG + Intronic
1048108516 8:131440229-131440251 ATATTTGGGAAGTGCAGCCTGGG + Intergenic
1048234649 8:132677781-132677803 CCATCTTGGAAGTGGAGACCAGG - Intergenic
1049432517 8:142571823-142571845 ACATCCTGGACATGGAGCCCTGG - Intergenic
1051523271 9:18014231-18014253 CCATTTTGCCAGTGGAGCACTGG - Intergenic
1053033903 9:34808629-34808651 CCATCTTGGAAGTAGAGACCAGG - Intergenic
1055297427 9:74848889-74848911 ACATTTTGGAAATTGAGCTCTGG - Intronic
1055583576 9:77732894-77732916 TCTCTGTGGAAGTGGAGCCCAGG - Intronic
1056798785 9:89676975-89676997 ACACTCTGGAAGTAGAACCCAGG + Intergenic
1058585242 9:106500826-106500848 ACAGTGTGGAAGGGGACCCCAGG + Intergenic
1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG + Intergenic
1061476748 9:130872731-130872753 CCATGTTGGAAGTTGGGCCCAGG + Intronic
1061557100 9:131377611-131377633 GCACTGTGGATGTGGAGCCCAGG - Intergenic
1062366055 9:136209580-136209602 CCGTTTTGGAAGTGGAGTGCTGG - Intronic
1186633574 X:11377813-11377835 ACAGTTGAGAAGTGGAGCCAAGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1188569055 X:31560225-31560247 ACAGTTTTGAAGTGGGGCCTGGG + Intronic
1189302616 X:39963267-39963289 CCATCTTGGAAGTGGAGACTGGG + Intergenic
1192251551 X:69417747-69417769 ACAGTGTGGAAGGGGACCCCAGG - Intergenic
1192368510 X:70495002-70495024 AAATTTTGGTTGTGGAGCCCAGG - Intronic
1193550710 X:82889113-82889135 CCATTTTTGAAGGGGAGGCCAGG + Intergenic
1193648203 X:84094345-84094367 AGATTTTGCAAGTGGAGGCCTGG + Intronic
1196470672 X:116021414-116021436 CCATTTTAGAAGTGGATACCAGG + Intergenic
1197008119 X:121528433-121528455 ACATTTTGGAAAGGGAGCATCGG - Intergenic
1198746712 X:139898443-139898465 ACATTTGGGTAGAGTAGCCCAGG - Intronic
1199158117 X:144573660-144573682 ACATTGTGGAAGTGAAGCATGGG - Intergenic
1199487691 X:148366316-148366338 GCATTTTTGAATTGGAGTCCTGG + Intergenic
1199868410 X:151874876-151874898 AAATTTTAGAAGTGCAGACCAGG - Intergenic
1201647656 Y:16253188-16253210 ACATATTTGAAGTAGAGGCCGGG + Intergenic
1201655155 Y:16332113-16332135 ACATATTTGAAGTAGAGGCCGGG - Intergenic
1201715943 Y:17043909-17043931 ACACTGTGGAAGGGGACCCCAGG - Intergenic