ID: 1003311147

View in Genome Browser
Species Human (GRCh38)
Location 6:4970960-4970982
Sequence TGACCCCTCCTCGCTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003311147_1003311158 20 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311158 6:4971003-4971025 GGGGGCAAGCAGAGGGAAAGGGG No data
1003311147_1003311148 -1 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311148 6:4970982-4971004 ATCTCAGAGCAGCAGCACCCAGG No data
1003311147_1003311152 12 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311152 6:4970995-4971017 AGCACCCAGGGGGCAAGCAGAGG No data
1003311147_1003311160 29 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311160 6:4971012-4971034 CAGAGGGAAAGGGGAGGACAAGG No data
1003311147_1003311149 0 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311149 6:4970983-4971005 TCTCAGAGCAGCAGCACCCAGGG No data
1003311147_1003311157 19 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311157 6:4971002-4971024 AGGGGGCAAGCAGAGGGAAAGGG No data
1003311147_1003311150 1 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311150 6:4970984-4971006 CTCAGAGCAGCAGCACCCAGGGG No data
1003311147_1003311156 18 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311156 6:4971001-4971023 CAGGGGGCAAGCAGAGGGAAAGG No data
1003311147_1003311151 2 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311151 6:4970985-4971007 TCAGAGCAGCAGCACCCAGGGGG No data
1003311147_1003311153 13 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311153 6:4970996-4971018 GCACCCAGGGGGCAAGCAGAGGG No data
1003311147_1003311159 23 Left 1003311147 6:4970960-4970982 CCAGGCACAGCGAGGAGGGGTCA No data
Right 1003311159 6:4971006-4971028 GGCAAGCAGAGGGAAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003311147 Original CRISPR TGACCCCTCCTCGCTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr