ID: 1003311650

View in Genome Browser
Species Human (GRCh38)
Location 6:4974248-4974270
Sequence CCAGAACCGGCTCTGAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003311650_1003311658 -1 Left 1003311650 6:4974248-4974270 CCCAAACTCAGAGCCGGTTCTGG No data
Right 1003311658 6:4974270-4974292 GCTCTTGGCTCCGGTGGCCTGGG No data
1003311650_1003311655 -10 Left 1003311650 6:4974248-4974270 CCCAAACTCAGAGCCGGTTCTGG No data
Right 1003311655 6:4974261-4974283 CCGGTTCTGGCTCTTGGCTCCGG No data
1003311650_1003311664 21 Left 1003311650 6:4974248-4974270 CCCAAACTCAGAGCCGGTTCTGG No data
Right 1003311664 6:4974292-4974314 GGAGCTGAGGCTACTTTTCAGGG No data
1003311650_1003311660 8 Left 1003311650 6:4974248-4974270 CCCAAACTCAGAGCCGGTTCTGG No data
Right 1003311660 6:4974279-4974301 TCCGGTGGCCTGGGGAGCTGAGG No data
1003311650_1003311659 0 Left 1003311650 6:4974248-4974270 CCCAAACTCAGAGCCGGTTCTGG No data
Right 1003311659 6:4974271-4974293 CTCTTGGCTCCGGTGGCCTGGGG No data
1003311650_1003311657 -2 Left 1003311650 6:4974248-4974270 CCCAAACTCAGAGCCGGTTCTGG No data
Right 1003311657 6:4974269-4974291 GGCTCTTGGCTCCGGTGGCCTGG No data
1003311650_1003311656 -7 Left 1003311650 6:4974248-4974270 CCCAAACTCAGAGCCGGTTCTGG No data
Right 1003311656 6:4974264-4974286 GTTCTGGCTCTTGGCTCCGGTGG No data
1003311650_1003311663 20 Left 1003311650 6:4974248-4974270 CCCAAACTCAGAGCCGGTTCTGG No data
Right 1003311663 6:4974291-4974313 GGGAGCTGAGGCTACTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003311650 Original CRISPR CCAGAACCGGCTCTGAGTTT GGG (reversed) Intergenic
No off target data available for this crispr